ID: 913532627

View in Genome Browser
Species Human (GRCh38)
Location 1:119743459-119743481
Sequence TCCAGCCATGGTAGGCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532617_913532627 28 Left 913532617 1:119743408-119743430 CCTGTGGCTGTCCCTGGTGGCCA 0: 1
1: 0
2: 3
3: 29
4: 280
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532616_913532627 29 Left 913532616 1:119743407-119743429 CCCTGTGGCTGTCCCTGGTGGCC No data
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532619_913532627 16 Left 913532619 1:119743420-119743442 CCTGGTGGCCAGCCCAGCTGCAG 0: 1
1: 0
2: 4
3: 55
4: 420
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532622_913532627 3 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532620_913532627 8 Left 913532620 1:119743428-119743450 CCAGCCCAGCTGCAGCAAAACCT 0: 1
1: 1
2: 3
3: 28
4: 312
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532621_913532627 4 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532618_913532627 17 Left 913532618 1:119743419-119743441 CCCTGGTGGCCAGCCCAGCTGCA 0: 1
1: 0
2: 1
3: 43
4: 418
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532627 Original CRISPR TCCAGCCATGGTAGGCGTCT TGG Intronic
900564797 1:3326964-3326986 TCCTCCCAGGGCAGGCGTCTGGG - Intronic
901719989 1:11189287-11189309 TGCAGCCATGGTAGGGGTGGAGG + Intronic
902673501 1:17992432-17992454 TCCAGCCATGCTGGGCTGCTTGG + Intergenic
902742024 1:18445416-18445438 TCCAGCCATGTAAGACGTGTCGG + Intergenic
902886274 1:19407231-19407253 TCCAGCCTTGGTCTGCTTCTTGG + Intronic
904348614 1:29890506-29890528 CCCAGCCATGGTAGGTGCTTTGG + Intergenic
913221997 1:116667466-116667488 CCCAGCCAGGGGAGGGGTCTCGG + Intronic
913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG + Intronic
917231373 1:172841511-172841533 GCCTGCCATGGGAGGAGTCTGGG + Intergenic
921004766 1:211082650-211082672 CCCAGCCAAGACAGGCGTCTGGG + Intronic
921203052 1:212825178-212825200 GGCAGCCTTGGTAGGCTTCTGGG - Intergenic
1073096141 10:100980914-100980936 CCCAGCCACAGTAGGGGTCTCGG - Exonic
1073418563 10:103405174-103405196 GCCTGGCATGGTAGGTGTCTAGG + Exonic
1080685922 11:34514722-34514744 CCCAGCCAAGATAGGGGTCTAGG - Intergenic
1088764904 11:112964871-112964893 TCCAGACATTGTAGACGTGTGGG + Intronic
1089567094 11:119377647-119377669 TGCAGCCAGGGTAGGAGGCTAGG - Intronic
1092144847 12:6207514-6207536 TCCAGCCAGGTTGGGCCTCTTGG + Intronic
1092167574 12:6352363-6352385 TCCAGCCCTGGTAGGGATTTGGG - Intronic
1097917305 12:65034707-65034729 TCCAGCCAAGCTAGGCTTCATGG - Intergenic
1104758191 12:131281864-131281886 TCCATCCCTGGCAGGGGTCTGGG - Intergenic
1104822726 12:131687506-131687528 TCCATCCCTGGCAGGGGTCTGGG + Intergenic
1108580690 13:51825902-51825924 CCCAGCCATGCTGGGCTTCTAGG + Intergenic
1115182393 14:30644242-30644264 TCCACCCTTGATAGGCATCTAGG + Intronic
1118819116 14:69333493-69333515 TCCAGCTATGACAGGCGTCCTGG - Exonic
1202836015 14_GL000009v2_random:77610-77632 ACCATCCCTGGGAGGCGTCTTGG + Intergenic
1125076137 15:35620656-35620678 TCCAGCCATGGTAGGCGCTCTGG + Intergenic
1129268775 15:74408807-74408829 TCCAGGCAGGGTAGGGGTCTGGG - Intergenic
1131532066 15:93202196-93202218 TCCAGCCAAGCTTGGCATCTAGG + Intergenic
1136175374 16:28512881-28512903 TGCAGCCATGGCAGGCACCTGGG + Intergenic
1140876670 16:79159065-79159087 TCCAGCCCCAGTAGGCTTCTGGG + Intronic
1141831212 16:86510824-86510846 TCCAGCCCTGGTAGGAGCCCCGG - Exonic
1144107414 17:11998112-11998134 TTCAGCCATTGTTGGCGTGTGGG - Intergenic
1157419328 18:47531946-47531968 CCCAGCCAGGGTGGGCGTCGGGG + Intergenic
1158800418 18:60901197-60901219 TCCAGCAATGCTATGTGTCTGGG + Intergenic
1160934358 19:1586232-1586254 TTCATCCATTGAAGGCGTCTGGG - Intronic
1163527548 19:17830780-17830802 TCCAGCCCTGGGAGGTGCCTGGG + Intronic
1165917485 19:39269565-39269587 CCCAGCCCTGGTGGACGTCTTGG + Exonic
1166785034 19:45362600-45362622 ACCAGCCGGGGTAGGCGCCTGGG - Intronic
925232981 2:2252374-2252396 TCCAGCCCTGGTCTGTGTCTGGG + Intronic
926316724 2:11715435-11715457 GCCATCCATGGTAGGGGTGTTGG + Intronic
927618253 2:24622611-24622633 TCCAGCACTGGTAAGGGTCTAGG - Intronic
929387788 2:41431534-41431556 TTCAGCCATGGTCAGCTTCTGGG - Intergenic
936370203 2:111897438-111897460 TCCAGCCAGTGTAGGGGTCAAGG + Intergenic
936627765 2:114166631-114166653 TCCATCCAGGGCAGGTGTCTGGG - Intergenic
946907926 2:224433587-224433609 GCCAGCCATGGAAGGCCTGTCGG - Intergenic
949006339 2:241650842-241650864 TCCATCCATGGTGGGTGTCTTGG + Intronic
1172255576 20:33514501-33514523 TCCAGCCATGCTAGCCTCCTTGG - Intronic
1173318930 20:41970067-41970089 TCCAGGCATGGTAGGGGGATGGG + Intergenic
1173495205 20:43513645-43513667 TCAAGCTAGGGTAGGAGTCTGGG + Intronic
1173522665 20:43711268-43711290 CCCAGCCATGGCAGGCCCCTGGG + Intronic
1174395793 20:50246261-50246283 TCCAGCCAGGGTGGGCACCTGGG + Intergenic
1176143956 20:63557264-63557286 TGCAGCCAGGGAAGGCTTCTGGG - Intergenic
1177350344 21:19931472-19931494 TCCAGCCATGCTAGTCGGTTTGG + Intergenic
1178352658 21:31883971-31883993 TCCAGGCATGGTAAGGGTCGGGG - Intronic
954106971 3:48414746-48414768 TCCAGCCAAGGGAAGGGTCTCGG + Intronic
956636752 3:71372362-71372384 TCTAGCCAGGGAAGGCCTCTTGG - Intronic
965547027 3:169926667-169926689 TCCTGCCATGGTAGGCAGCGGGG - Exonic
967622119 3:191646361-191646383 TCCACCCATGATGGGCATCTAGG - Intergenic
973051700 4:45607060-45607082 TCTGGCCAGGGTAGGTGTCTTGG - Intergenic
973772596 4:54220400-54220422 CCCAGCCTTGGTAGGCCTCCTGG + Intronic
978534441 4:109746075-109746097 TCCAGCCATGGCTGGCTTCATGG - Intronic
992830801 5:80591585-80591607 TCCAGCCATGGAAGGGCCCTCGG - Intergenic
996617927 5:125463830-125463852 GACAGCCATGGTAGGTGTCTTGG - Intergenic
1001771762 5:174302209-174302231 TCCAGCCATGGTGGGTGTTAGGG + Intergenic
1002898033 6:1390358-1390380 TCCAGCCCTGGTAGGCGCCGCGG - Exonic
1004334522 6:14752339-14752361 TGCAGGCATGGTAGATGTCTTGG - Intergenic
1007075307 6:39062362-39062384 TCCAGCCAAGGTGGGCATCTGGG + Intronic
1010048114 6:71470876-71470898 TCAAGCAATGGTTGGCTTCTTGG - Intergenic
1011149609 6:84255802-84255824 TGCAGCCATGCTAGGTGTTTGGG - Intergenic
1013345636 6:109257633-109257655 TGCAGGCATGGCAGGCCTCTTGG - Intergenic
1015895339 6:138011354-138011376 TCCAGCCATGGTTTGGGTCATGG + Intergenic
1017507438 6:155081552-155081574 TCCAGCCATGGTTAACTTCTAGG + Intronic
1024181032 7:46895084-46895106 TCCAGCCTTGATGGGCATCTAGG + Intergenic
1024981528 7:55161319-55161341 TCCAGTCACGGTCGGCCTCTGGG + Intronic
1025850088 7:65237975-65237997 TCCAGTCATGGCTGGCCTCTGGG - Intergenic
1032348475 7:131138853-131138875 TTCAGTCATTGTATGCGTCTTGG + Intronic
1033429372 7:141274892-141274914 TCCACCCTTGGTTGGAGTCTGGG - Intronic
1037400720 8:18492815-18492837 TCCAGCACTGATAGGCATCTAGG + Intergenic
1039661899 8:39477190-39477212 TTCAGCCCTCCTAGGCGTCTGGG - Intergenic
1042597764 8:70467896-70467918 CCCAGACATGGTAGGCCTGTTGG + Intergenic
1048410227 8:134164709-134164731 TCCAGCCATGGTCTTCTTCTGGG + Intergenic
1059507567 9:114813632-114813654 TCAAGACCCGGTAGGCGTCTTGG - Intergenic
1061166731 9:128927187-128927209 TCGAGCCCAGGTAGGTGTCTGGG + Exonic
1062026498 9:134343047-134343069 CCCAGCCCTGGGAGGTGTCTTGG + Intronic
1062111873 9:134786237-134786259 TCCAGCTATGTTAGGTGTCCCGG + Intronic
1186220018 X:7340838-7340860 TCCCGCCATTGTATGCGTTTAGG - Intronic
1189709625 X:43796105-43796127 TCCAGCTAAGGTTGGAGTCTGGG - Intronic
1196663764 X:118295060-118295082 TTCAGCAATGGCAGGCCTCTTGG - Intergenic
1200958499 Y:8973770-8973792 TCCAGCCCGGGCAGGCGCCTCGG + Intergenic