ID: 913532627

View in Genome Browser
Species Human (GRCh38)
Location 1:119743459-119743481
Sequence TCCAGCCATGGTAGGCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532617_913532627 28 Left 913532617 1:119743408-119743430 CCTGTGGCTGTCCCTGGTGGCCA 0: 1
1: 0
2: 3
3: 29
4: 280
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532622_913532627 3 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532616_913532627 29 Left 913532616 1:119743407-119743429 CCCTGTGGCTGTCCCTGGTGGCC No data
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532621_913532627 4 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532618_913532627 17 Left 913532618 1:119743419-119743441 CCCTGGTGGCCAGCCCAGCTGCA 0: 1
1: 0
2: 1
3: 43
4: 418
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532620_913532627 8 Left 913532620 1:119743428-119743450 CCAGCCCAGCTGCAGCAAAACCT 0: 1
1: 1
2: 3
3: 28
4: 312
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532619_913532627 16 Left 913532619 1:119743420-119743442 CCTGGTGGCCAGCCCAGCTGCAG 0: 1
1: 0
2: 4
3: 55
4: 420
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532627 Original CRISPR TCCAGCCATGGTAGGCGTCT TGG Intronic