ID: 913533750

View in Genome Browser
Species Human (GRCh38)
Location 1:119751832-119751854
Sequence ATGCATGTTGTTTTGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913533750_913533753 23 Left 913533750 1:119751832-119751854 CCATGCTGCAAAACAACATGCAT 0: 1
1: 0
2: 0
3: 23
4: 187
Right 913533753 1:119751878-119751900 TATAAAACCTGTAGAAATCATGG 0: 1
1: 0
2: 3
3: 21
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913533750 Original CRISPR ATGCATGTTGTTTTGCAGCA TGG (reversed) Intronic
902285826 1:15408062-15408084 ATGTAAGTTGTTTTGCAAGAAGG + Intergenic
908685810 1:66718240-66718262 ATGCATTTTGTTTGGCAGGAAGG + Intronic
912139538 1:106705785-106705807 ATGCATGTTATTTTGCAGATTGG + Intergenic
913533750 1:119751832-119751854 ATGCATGTTGTTTTGCAGCATGG - Intronic
916517452 1:165532862-165532884 TTTCATTTTGTTTTGCAGGAGGG + Intergenic
916608025 1:166362335-166362357 AAGCCAGTTATTTTGCAGCATGG + Intergenic
917359534 1:174160165-174160187 ATGCTTGTGGTTTTGCAGTTTGG + Intronic
917385247 1:174465772-174465794 ATGCATGTTGTTGTGGTGGAAGG - Intronic
918188592 1:182149573-182149595 ATGTATGTTGTAATGGAGCAAGG - Intergenic
918393114 1:184087074-184087096 ATGCCTGGTGTTTAGCAGGATGG + Intergenic
918822299 1:189270505-189270527 TTGCATGTGCTTTTGCAGCCTGG - Intergenic
921348778 1:214214225-214214247 ATGCATTTTGTTTTGCAAGCAGG - Intergenic
921611538 1:217217917-217217939 AAGCATGGTGTTTGGCAGAAGGG - Intergenic
922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG + Intronic
1063792202 10:9464645-9464667 ATGCATGTGCTTAGGCAGCAAGG + Intergenic
1064334150 10:14423300-14423322 TTGGAAGTTCTTTTGCAGCAGGG + Intronic
1064364262 10:14692782-14692804 ATGAACGTTGTCTTGCTGCACGG + Intronic
1065696326 10:28383768-28383790 ATGCATGCAGTCTTCCAGCAGGG + Intergenic
1066307849 10:34163801-34163823 ATCCAGGATGTTTTACAGCAAGG + Intronic
1067160078 10:43818489-43818511 GTGCTTTTTGTTTTTCAGCAAGG + Intergenic
1067787375 10:49260368-49260390 TTGGATTTTGTTTTGCATCAGGG + Intergenic
1068459076 10:57302605-57302627 GTGCATGTGCTTTTGAAGCAGGG - Intergenic
1068519681 10:58064449-58064471 ATGCTTGTTCTGTTGCACCATGG - Intergenic
1070975124 10:80600308-80600330 ATTAATGTTGCTTTGAAGCATGG + Intronic
1071110005 10:82144667-82144689 ATGCACAATGTTTTGTAGCAGGG + Intronic
1072391445 10:94991640-94991662 AGGCATGTAGTTTGGCAGGAAGG + Intergenic
1078962929 11:16300636-16300658 ATTCCTGCTGTTTTGCAACAGGG - Intronic
1078979099 11:16511773-16511795 CTGCATGTTATTTTGCAACTTGG - Intronic
1079378795 11:19918418-19918440 ATGCCTGTTTTTTTCCATCATGG + Intronic
1083843711 11:65318939-65318961 ATGCATGTTGTGTAACTGCATGG - Intronic
1084133872 11:67159799-67159821 ATGGATCTGTTTTTGCAGCAGGG + Intronic
1085722614 11:78926157-78926179 ATGCATGTTATTTAGAAGCATGG + Intronic
1088153493 11:106776544-106776566 ATGCCTACTGTGTTGCAGCAGGG - Exonic
1091293531 11:134456228-134456250 ATGCATGTCTTTTTTCAGAAAGG + Intergenic
1091934000 12:4420707-4420729 ATGCAGGCTGTTTTGGAGTATGG - Intergenic
1091995652 12:4991323-4991345 AGGCCTTTTATTTTGCAGCATGG - Intergenic
1095112277 12:38310798-38310820 ATGCATGGTGTTTTAGAGCCAGG + Intergenic
1096307559 12:50491482-50491504 ATGCATGTTTTTTAGTGGCAAGG - Intergenic
1096900126 12:54868678-54868700 ATACAAGTTATTTTTCAGCAAGG - Intergenic
1098514754 12:71361424-71361446 ATCCATATTGTTTTGCATAATGG - Intronic
1098514850 12:71362931-71362953 CTTCATGTTGTTTTGCATAATGG - Intronic
1100182528 12:92100717-92100739 ATGCATGTTATTTTCCAGCCAGG - Intronic
1100793722 12:98158057-98158079 ATGCATGCTGGTTTGGAGGAGGG + Intergenic
1101183863 12:102251826-102251848 ATGCATTTTATTTTCTAGCAGGG + Intergenic
1101291816 12:103377963-103377985 ATGCATTTTGTTTTAAAGCAGGG + Intronic
1102703327 12:114859427-114859449 ATGCAAGTAGTTTTGCAGGATGG + Intergenic
1103197343 12:119056153-119056175 ATGCAGGCTGTTTTGGAGCCAGG - Intronic
1105297620 13:19103372-19103394 ATGCATATTGTTTTTCTTCAGGG + Intergenic
1108204636 13:48075213-48075235 ATGAATGTTGTTTTGTTACATGG + Intronic
1109776727 13:67050860-67050882 ATACATGTTGTTTTGTACCTAGG - Intronic
1109784901 13:67160613-67160635 CTGCATGTTGTCTTGAATCATGG - Intronic
1110164392 13:72421393-72421415 AAGCATGTGGCTTTGAAGCATGG - Intergenic
1111804165 13:93018389-93018411 ATGCTTGTTGTTTTAAAGTATGG - Intergenic
1112681902 13:101776618-101776640 ATGCGTTTTGTTCTGCAGCTGGG - Intronic
1113408591 13:110064017-110064039 ATGGATGTTGTTTTTCAAAAAGG - Intergenic
1116119833 14:40708285-40708307 ATGTATATTGTGTTGCAGTAGGG - Intergenic
1116254131 14:42528194-42528216 GTGCATGCAGTTTTGCAGGAGGG + Intergenic
1117927777 14:60802337-60802359 ATGCTTATTTTTTTGTAGCAAGG - Intronic
1118028496 14:61796019-61796041 CTTCATGCTGTTTTCCAGCATGG + Exonic
1119141772 14:72273918-72273940 ATGCCTCTTCTTTTGCAGCTAGG - Intronic
1119514975 14:75240827-75240849 AGGCATGTTGTCTTCCAGGAAGG - Intronic
1120367128 14:83585274-83585296 ATGTAGGTTGGTTTGCAGAATGG + Intergenic
1123837696 15:24212623-24212645 CTGCTTGTAGTTTTGCAGCATGG - Intergenic
1127477484 15:59348335-59348357 TTACATGGTGTGTTGCAGCATGG + Intronic
1127762847 15:62156227-62156249 ATGATTGTAATTTTGCAGCATGG - Intergenic
1127974549 15:63987544-63987566 ATGCATGGTCTACTGCAGCACGG + Intronic
1129056236 15:72822357-72822379 AAGAATGTTGTTTTCTAGCATGG + Intergenic
1131386259 15:92010611-92010633 ATGAATTTTGTTTTGCAGACAGG - Intronic
1131872385 15:96775921-96775943 ATGCAGGATGTCCTGCAGCAAGG - Intergenic
1131913576 15:97236219-97236241 AGGCATGTGCTTTTGCAGGAAGG + Intergenic
1133899247 16:9957857-9957879 CTGCCTGTTGGTTTTCAGCAGGG + Intronic
1137411932 16:48235951-48235973 TTCCATGTTCTTATGCAGCAGGG + Intronic
1137534802 16:49312011-49312033 TTCCATGTTGTTTTCCATCACGG + Intergenic
1139265591 16:65635593-65635615 CTGCATGTTTCTTGGCAGCATGG + Intergenic
1140861360 16:79021184-79021206 CTGCATGTAGATTTGCAGAATGG - Intronic
1141908598 16:87043408-87043430 GAGCATGTTGTTTGGCACCAGGG + Intergenic
1146552914 17:33797569-33797591 ATGCATGTTGATGTGAAGCTTGG + Intronic
1147462524 17:40582533-40582555 ATGCTTCCTGTTTTGCTGCATGG + Intergenic
1149189796 17:54047091-54047113 ATACATGTTGTTTCTCAGCAGGG - Intergenic
1150283503 17:63943085-63943107 CTGGATCTTGTTCTGCAGCATGG + Exonic
1152683444 17:81682065-81682087 CTGCAAGTTGTTCTGCAGAAAGG + Exonic
1155241390 18:23866928-23866950 ATGTGTGTGTTTTTGCAGCAGGG + Intronic
1156684142 18:39623799-39623821 CAGCATCTTGTTTTGAAGCATGG + Intergenic
1157465002 18:47936159-47936181 AGAAGTGTTGTTTTGCAGCATGG - Intergenic
1158725318 18:59966641-59966663 ATCCATCTTTTTTTTCAGCATGG + Intergenic
1163481742 19:17560552-17560574 CTTAATGTTGTTTTGCAGAAGGG + Intronic
1168487749 19:56779107-56779129 ATGTATGATGTTTAGCTGCAAGG + Intronic
1168674445 19:58266812-58266834 ATGTATTTTGCTCTGCAGCAAGG + Intronic
925849913 2:8070167-8070189 ATTCTTGTTGTTTAGCAACAGGG + Intergenic
926950215 2:18234725-18234747 ATGCATGTTGTTTTAAAACGTGG - Intronic
930219096 2:48727501-48727523 ATGAATGTTGCTTTGCATCACGG + Intronic
930663309 2:54077487-54077509 GTGCATGCAGTATTGCAGCACGG + Intronic
931020652 2:58041235-58041257 TTACATTTTGTTTGGCAGCAGGG + Intronic
931556718 2:63514094-63514116 ATGCATGTTGTTTATAAACATGG + Intronic
932236973 2:70128594-70128616 ATGCATGCTGTCTTGCGGCATGG - Intergenic
934753740 2:96810904-96810926 AAGCCTGGAGTTTTGCAGCAGGG - Exonic
937586965 2:123564527-123564549 ATGCATTTAACTTTGCAGCAGGG - Intergenic
939096326 2:137837156-137837178 AGACAAGTTGTCTTGCAGCAAGG + Intergenic
939729553 2:145765101-145765123 CTTAATGTTGTTTTGCAGCTGGG - Intergenic
940265802 2:151835368-151835390 ATGTATTTAGCTTTGCAGCAAGG + Exonic
941917152 2:170820369-170820391 CTGCTTGCTGTTTTACAGCAGGG - Intronic
942725907 2:179007470-179007492 ATGCATGTTACTTTGGAACATGG + Intronic
943735547 2:191350002-191350024 AGGCATGTTGTTTTGCATCGTGG + Intronic
946144844 2:217722821-217722843 ATGTATGTGGATTTTCAGCAGGG + Intronic
1169335239 20:4750556-4750578 ATGCCTGTTGTTTTTAACCATGG - Intergenic
1170179092 20:13508908-13508930 CTCCATGTTGTTTTCCAGAATGG - Intronic
1170645475 20:18193426-18193448 AAGCTTGTTGTTTTGCAGCTAGG + Intergenic
1173654718 20:44691672-44691694 ATGCCTGTTGCTTGGCAGGATGG + Intergenic
1174283225 20:49454230-49454252 ATCCAGGTCGTTTTGCAGCTGGG - Intronic
1174646463 20:52090139-52090161 ATGCATCTTATTTAGAAGCAGGG + Intronic
1174871614 20:54187823-54187845 ATGAATGAAGTTATGCAGCAGGG - Intergenic
1175389838 20:58620146-58620168 CTGCATGATGCTTTGCAGCTGGG + Intergenic
1175471009 20:59228413-59228435 ATGGAAGTTGGTTGGCAGCATGG - Intronic
1175471012 20:59228432-59228454 ATGGAAGTTGGTTGGCAGCATGG - Intronic
1175471015 20:59228451-59228473 ATGGAAGTTGGTTGGCAGCATGG - Intronic
1175634105 20:60566350-60566372 ATGCATGTTGTTTTTCAAACTGG - Intergenic
1175938954 20:62528925-62528947 GTGCAGGTTGTTTTGCGGCAGGG + Intergenic
1178623278 21:34194754-34194776 ATGCAGGTTCTGATGCAGCAGGG - Intergenic
1183576321 22:38692331-38692353 ATGCTTGCTGTCTTACAGCAAGG + Intronic
1183788975 22:40049565-40049587 ATGGATTTTGTTTTGGAGTATGG - Intronic
1184118067 22:42433414-42433436 AGGCATGTTGTTTTGCCTCCTGG - Intergenic
953477534 3:43218404-43218426 ATGAATGTTGGTTTGCAACAAGG - Intergenic
956359810 3:68435738-68435760 ATGCTTTTGGTTTTGCATCAAGG + Intronic
957206389 3:77204776-77204798 ATCCATGTTGTTTTGTTGAAAGG + Intronic
957301149 3:78392762-78392784 ATGGATTTTCTTTTGAAGCATGG + Intergenic
957315264 3:78568580-78568602 ATGCATATTATTTTACAGCGTGG + Intergenic
958150902 3:89693405-89693427 ATGCATTTGGTTTTGCATCTAGG + Intergenic
959654711 3:108789726-108789748 ATGAATGTTGTTTTGTTACATGG - Intergenic
959755103 3:109887859-109887881 ATTCTTGTTGTTTTACAGAATGG - Intergenic
960291718 3:115893882-115893904 ATGCATGTTGATTCCCAGCACGG - Intronic
961824842 3:129593555-129593577 ATGCATGACGTTCTCCAGCATGG + Intronic
963771028 3:149386350-149386372 ATGCTTGCTTTTTTGCAGAAAGG + Intergenic
963972933 3:151449442-151449464 ATGCATATTATGTTGTAGCAGGG - Intronic
964811934 3:160674458-160674480 AAGTCTGTTGTCTTGCAGCATGG + Intergenic
970764760 4:19534305-19534327 ATGCATTGAGTTTTGAAGCAGGG - Intergenic
971391013 4:26185164-26185186 AGTTATGTTGTTTTGCATCAAGG + Intronic
975243141 4:72086263-72086285 ATCCTTGTTGTTTTGCAGTGTGG + Intronic
979032707 4:115671008-115671030 AAGAATGTTGTTTTGGAGAACGG + Intergenic
980293749 4:130881343-130881365 TTGCATTTTGTTTTACAGAAAGG - Intergenic
982438906 4:155411351-155411373 AGGCACGTTGCTTTGCAGTAAGG + Intergenic
982489338 4:156009388-156009410 ATGTTTGGTGTTTTTCAGCATGG + Intergenic
989190406 5:38665165-38665187 ATGCATGTTATTTTGTAGAAAGG - Intergenic
989306143 5:39958909-39958931 CTGCATTTTGTAATGCAGCAAGG + Intergenic
991155096 5:63424834-63424856 ATGCATGCTGATTAGCAGTAAGG - Intergenic
991560471 5:67946126-67946148 ATGCGTGTTGATTTGAAGAAGGG - Intergenic
991635277 5:68698558-68698580 ATGCATGTTGTACTGTAGAAGGG - Intergenic
992784656 5:80157815-80157837 ATGCTTGTTGTTTTACAGGTAGG - Intronic
994167196 5:96620047-96620069 ATGCATGTTAATTTGCAGGCAGG + Intronic
995041012 5:107587972-107587994 GTGCACGTTGGTTTGCAGCCTGG - Intronic
995294806 5:110507269-110507291 ATGCATACTGTTATGAAGCAAGG - Intronic
996383346 5:122884891-122884913 ATGCATTTTGTTTTCCACAATGG - Intronic
997106612 5:131027621-131027643 ATGCATGTTGTTGTTAAGAAAGG - Intergenic
1000777643 5:165440168-165440190 TTCCATGTTGTTTTGTTGCAGGG + Intergenic
1001161776 5:169324370-169324392 ATGCATGTTTTTCTGCTGAAGGG - Intergenic
1004153899 6:13149677-13149699 ATGCTTATTGTCTTGCAACAAGG + Intronic
1004338030 6:14782462-14782484 ATTCTTGTTGTTTATCAGCACGG + Intergenic
1004676701 6:17849686-17849708 TAGCATTTTGTTTTGCAGCTGGG + Intronic
1004855079 6:19741332-19741354 AAGCATGTTATTTTGGAACATGG - Intergenic
1007042903 6:38741394-38741416 ATGTTTGTTGTTTTGAGGCAGGG - Intronic
1007137982 6:39541323-39541345 GTACATGTTGTTTTGGGGCAAGG - Intronic
1007295658 6:40818859-40818881 AGGCATGTTGTCTTGCAGGTGGG + Intergenic
1010541503 6:77097935-77097957 ATCCATTTTGTTTTGCAACAGGG + Intergenic
1013824228 6:114192115-114192137 ATGGATGTTATTTTGAACCAGGG + Intronic
1014893001 6:126865419-126865441 AAGCATGCTGTTTTACAGAAGGG + Intergenic
1015569823 6:134609370-134609392 ATGCATGTTCTGTTGGAGGAAGG - Intergenic
1015988075 6:138906079-138906101 ATGCATGTTTTTCTGAACCAGGG - Intronic
1016299070 6:142609711-142609733 TTGCATGCTCTTTTGCAGCTGGG + Intergenic
1016889026 6:148987260-148987282 ATGCATGCTGCTTGGAAGCAGGG + Intronic
1017700003 6:157059858-157059880 ATGCATTTTGTTTTAGAACAAGG + Intronic
1018094213 6:160371130-160371152 AGGCATGTTGTTGTGCACTAAGG - Intronic
1018298225 6:162372187-162372209 TTCCATGTCGTTTTGCAGCCAGG + Intronic
1019771535 7:2886557-2886579 CTCCATGTTCTTTTGCAGAAAGG + Intergenic
1020975225 7:14998105-14998127 ATGCATGTTGTTTTTCATCCTGG + Intergenic
1024303433 7:47905448-47905470 ATGCATGCAGATTGGCAGCAAGG + Intronic
1026576372 7:71574864-71574886 ATGCATGTCCTTTAGCAGAAAGG + Intronic
1028331327 7:89596920-89596942 ATACAGGTTGTTTTTCAGCCTGG - Intergenic
1028399286 7:90407339-90407361 ATGAATGTTGTTTTGTAAAATGG + Intronic
1030253222 7:107474074-107474096 CTGCATGTTGATTTCCAGAATGG - Exonic
1030377370 7:108769451-108769473 ATGCAAGTTATATTACAGCAAGG - Intergenic
1031827367 7:126582821-126582843 ATGTATGTTGGTTTACAACATGG + Intronic
1033834885 7:145298186-145298208 CTGGATGTTGTTTTGGAGCTTGG + Intergenic
1037024594 8:14018639-14018661 ATGCATCATGTTTTGCATAAAGG - Intergenic
1037268650 8:17099797-17099819 ATGACTGTTGATTTGAAGCATGG - Intronic
1037527047 8:19735524-19735546 GTGCATGTAATTTTGCAGCATGG - Intronic
1040307279 8:46218696-46218718 ATGCATGAGGTTTTGGAGCAGGG - Intergenic
1040444373 8:47478571-47478593 ATGAATGTGGCTCTGCAGCAGGG - Intronic
1040487047 8:47883534-47883556 ATGCATGAGGTTGAGCAGCAGGG - Intronic
1040558636 8:48504077-48504099 ATAAATGTCGTTTTGCAGAATGG + Intergenic
1042025612 8:64420492-64420514 AAGTATGTGGCTTTGCAGCAAGG - Intergenic
1043126085 8:76397434-76397456 ATACATCGTGTTTTGCATCAGGG - Intergenic
1044041447 8:87373530-87373552 ATGTAACTTGTTTTTCAGCAAGG + Intronic
1044336860 8:90995487-90995509 ATGCAAATTGTTTTGCTGCTAGG - Exonic
1044421353 8:91999490-91999512 AAGCATTTTGTTTTCAAGCAGGG + Intronic
1045027908 8:98107093-98107115 GTGCATGTTGTTCTGCATCTTGG + Intronic
1045330178 8:101148987-101149009 ATGGATGTTGTTATGATGCAAGG - Intergenic
1045895623 8:107212625-107212647 ATGCATGTTGCTATGCAAAAGGG - Intergenic
1046131484 8:109973601-109973623 ATGCATGCATTTTTGGAGCATGG + Intronic
1047572804 8:126118890-126118912 CTGCATGTTGTTTTCCATAAAGG + Intergenic
1047657647 8:126995985-126996007 GTCTATGTTGTTTTACAGCAGGG - Intergenic
1050120681 9:2303970-2303992 CTGCATGTTGTTTTGGTACATGG + Intergenic
1055149543 9:72979570-72979592 ATGTATGGTCTTTTGCAACAGGG - Intronic
1055525199 9:77126440-77126462 AGGTATGTTGTTTTTCAGAAAGG + Intergenic
1055981195 9:82002532-82002554 ATGCATGTTACTCTGCAGCACGG + Intergenic
1056489290 9:87088939-87088961 ATGCATGAAGTGTTGCAGCAAGG - Intergenic
1057989062 9:99748715-99748737 ATGTATGTTTTCTTCCAGCATGG - Intergenic
1058662510 9:107279961-107279983 ATACATGTTGTTTGAAAGCATGG - Intergenic
1193540897 X:82771053-82771075 ATCTATGATGTTTTTCAGCAGGG + Intergenic
1194452457 X:94061546-94061568 ATGGATGATGTTTAGCATCATGG + Intergenic
1195919116 X:109964803-109964825 ATGCATGTTATTTATCAGTATGG + Intergenic
1198829782 X:140737489-140737511 ATGCATTGTGTTTTTCAGAATGG - Intergenic
1200818369 Y:7556465-7556487 CTGCATGTCTTTTTTCAGCAAGG - Intergenic