ID: 913539209

View in Genome Browser
Species Human (GRCh38)
Location 1:119802922-119802944
Sequence CTGGTGAAATGGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 623}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913539209_913539218 11 Left 913539209 1:119802922-119802944 CCCTCTTCTCTCCATTTCACCAG 0: 1
1: 0
2: 2
3: 58
4: 623
Right 913539218 1:119802956-119802978 TCTCTTCATAGTGCCCAGGAAGG 0: 1
1: 0
2: 7
3: 96
4: 1890
913539209_913539217 7 Left 913539209 1:119802922-119802944 CCCTCTTCTCTCCATTTCACCAG 0: 1
1: 0
2: 2
3: 58
4: 623
Right 913539217 1:119802952-119802974 GGCTTCTCTTCATAGTGCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913539209 Original CRISPR CTGGTGAAATGGAGAGAAGA GGG (reversed) Intronic
900433286 1:2612821-2612843 AGGGTGGGATGGAGAGAAGAGGG + Intronic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
901928551 1:12582762-12582784 CTGGTGAACGGGAGAGTGGACGG - Intronic
902111667 1:14084144-14084166 GTGGTCAGATGGAGAGAAGCGGG + Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903393456 1:22981500-22981522 GTAGTGAGATGGAGAAAAGAAGG + Intergenic
903564730 1:24256343-24256365 CCTGTGAAATGGAGACGAGAAGG - Intergenic
904232645 1:29089011-29089033 CTGGTGTCATGGGAAGAAGATGG + Intronic
904490631 1:30856936-30856958 CTGGTGCAATGGGGAGAATAAGG - Intergenic
905835966 1:41121444-41121466 CTTGTGAAAGAGAGAAAAGAAGG + Intronic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
906113364 1:43339006-43339028 ATGGGGATATGGAGAGAAAAAGG + Intronic
906799250 1:48721632-48721654 GTGCTGAAATGGGGAGAGGAAGG - Intronic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
907586282 1:55620749-55620771 CTAGTGAAGTTGTGAGAAGAGGG + Intergenic
908567556 1:65373415-65373437 CTGGTGAAAATGTGAGAAAAGGG - Intronic
909865739 1:80667953-80667975 CTGGAGGAATAGAGATAAGATGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910119213 1:83766703-83766725 CTGGTGAAACGCTGAGAAGATGG - Intergenic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
910534104 1:88276865-88276887 CTGGTGAACTGAAGAGGATATGG - Intergenic
910606944 1:89097140-89097162 TGGGAGAAATGGAGAGATGATGG + Intergenic
910719849 1:90274063-90274085 CTGGTGAAAAAGTGAGATGAGGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911171974 1:94779934-94779956 ATGTTGAAAGGGAGAGAGGAGGG - Intergenic
911675426 1:100653455-100653477 CTGGTGAAGTTGGGAGAAAAAGG + Intergenic
912121724 1:106479706-106479728 CTAGTGGAATTGTGAGAAGAGGG + Intergenic
912522489 1:110255334-110255356 GGGGTGAGCTGGAGAGAAGACGG - Intronic
912868979 1:113285904-113285926 CTGGTAATAGGGAGAGAACAAGG + Intergenic
913370886 1:118097669-118097691 CTGGTCAGATGGTGAGATGATGG - Exonic
913435764 1:118845877-118845899 TTGGGGAAATGGAGAGATGGTGG - Intergenic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
913509678 1:119550316-119550338 CTGTTAGAATGGAGAGAGGAAGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914696891 1:150091524-150091546 CCAGTGAAATGGAGACAAGTTGG - Intronic
914892309 1:151637104-151637126 ATGGTAAAATGGAAAGAAAATGG - Intronic
914989620 1:152487025-152487047 CTGGAGAAAAGCAGAGAAGCAGG - Intergenic
915032938 1:152899749-152899771 CTGGGGAAATGGGGAGATGTTGG - Intergenic
915107609 1:153544108-153544130 CTGGTGCAATGGAAAAATGACGG + Intronic
915626894 1:157119355-157119377 CTGGTGAAGTGGGGGAAAGAAGG + Intergenic
915627682 1:157125584-157125606 CTGGTGAAATGGGGACATTAAGG + Exonic
915755348 1:158254434-158254456 TTGGTGACAAGGAGAGAAGCTGG + Exonic
915969030 1:160339475-160339497 CTGGAGAAATGGTGAGAGAAGGG - Intronic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
916846254 1:168653527-168653549 CTTGTGAATTGGAAAGAACAAGG + Intergenic
918470247 1:184865116-184865138 CTGGTGAGGTGCAGAGAAAAGGG + Intronic
919062082 1:192646005-192646027 CTGGTGAAATGGAAAGAGCTAGG - Intronic
919070329 1:192747474-192747496 GTGGTGAAATGGAGAGAGTTAGG + Intergenic
919254593 1:195105150-195105172 CTAGTGCAATTGTGAGAAGAGGG - Intergenic
919472739 1:197999191-197999213 CTGGTCAGAGGGAGAGATGAAGG - Intergenic
919932764 1:202232163-202232185 CTGGTTAAAGTGAGTGAAGAGGG + Intronic
920244710 1:204578970-204578992 CTGGTGAAACCGAGAGGAGGAGG + Intergenic
921152846 1:212415403-212415425 CTGGAATAATGGAGAGAACATGG - Intergenic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
921384549 1:214555338-214555360 TTGGAGTAATGGAGAGAAGTGGG + Intergenic
921519556 1:216142947-216142969 GAGGTGTTATGGAGAGAAGAGGG - Intronic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
921705915 1:218323172-218323194 CAGGTGACAAGGAAAGAAGAAGG - Intronic
921807688 1:219474791-219474813 CTGGAGAAAGGGAGAGATCACGG - Intergenic
921897990 1:220421103-220421125 CAGGTGAAATGGGGAGGGGAGGG - Intergenic
922118997 1:222644041-222644063 CTGGGGAAAAGGAGAAAAGCAGG - Intronic
923512866 1:234667729-234667751 CTGATGGAAAGAAGAGAAGAGGG - Intergenic
923747833 1:236719090-236719112 ATGGTGAAAGGGAGGGAAGAAGG - Intronic
924709161 1:246519640-246519662 CTAGGGGAATGGGGAGAAGAAGG + Intergenic
924811022 1:247402160-247402182 CTGATGAGATGGAGAGGTGAAGG + Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1063295499 10:4801048-4801070 ATGTTTAAATTGAGAGAAGATGG + Intronic
1063311105 10:4952800-4952822 CTGGAGAAATGCAGAGATGCAGG + Intronic
1063316693 10:5013595-5013617 CTGGAGAAATGCAGAGATGCAGG - Intronic
1063376033 10:5554974-5554996 CTGCTGAAGTGGAGAGAAAAGGG + Intergenic
1063607955 10:7539554-7539576 GTGGTGAGAAAGAGAGAAGATGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1063919699 10:10920685-10920707 AGGGAGAAATGGAGAAAAGAAGG + Intergenic
1064841047 10:19592384-19592406 CTGGTGAGTTGGAGATAAGATGG - Intronic
1064852059 10:19719341-19719363 CTTGTGAAGTGGAGTGAAGACGG + Intronic
1065100619 10:22327739-22327761 CAGATGAAATGAAGAGAAGAAGG + Exonic
1065766882 10:29038518-29038540 CTGCAGAAAAGGAGAGAAAAAGG - Intergenic
1065941726 10:30570855-30570877 ATGTTGAAATGGAGTGATGAGGG + Intergenic
1066251729 10:33639671-33639693 TTTTTGAAAAGGAGAGAAGAAGG - Intergenic
1066704580 10:38164325-38164347 TAGGTGAAAGGGAGAGAGGATGG - Intergenic
1066985997 10:42466873-42466895 CAGGTGAAAGGGAGAGAGGATGG + Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068252116 10:54456127-54456149 CTAGTGGAATAGTGAGAAGAGGG + Intronic
1068943145 10:62701199-62701221 CTGGTGCAAGGAACAGAAGAAGG + Intergenic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1069954812 10:72043451-72043473 CTGGGGAAAGGAGGAGAAGAGGG + Intergenic
1070224139 10:74483001-74483023 CTATTGGAATGGTGAGAAGAGGG - Intronic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071098660 10:82009996-82010018 CTGGAGAAGTGGAGATAACAAGG + Intronic
1071219294 10:83445013-83445035 CTGGCAAAAAGAAGAGAAGATGG + Intergenic
1071499570 10:86193759-86193781 CTGGTGGAATGGAGACAAGCTGG - Intronic
1072647363 10:97267468-97267490 CTAGTGGAATTGTGAGAAGAGGG - Intronic
1073526267 10:104185040-104185062 CTGGTGAATGGGAGAGATGATGG - Exonic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073773552 10:106761629-106761651 CTGCTGAATTTGGGAGAAGATGG - Exonic
1074642388 10:115401488-115401510 CTGCTGAAATGGAGAAAATGAGG + Intronic
1074787851 10:116857028-116857050 CAGGTGAAATGGAAAGATAATGG - Intronic
1075311965 10:121421868-121421890 CAGGTGAAATGGAGAAAAAGAGG + Intergenic
1075826110 10:125358290-125358312 CTGGTGGAACTGTGAGAAGAAGG - Intergenic
1075903859 10:126064160-126064182 CTGGTGAAATGGTGAACTGATGG + Intronic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077765814 11:5158976-5158998 CTGGTGAAAGAAATAGAAGAGGG - Intronic
1078481658 11:11681609-11681631 CAGGTGAAAGAGAGAGAAGAAGG + Intergenic
1078484242 11:11706909-11706931 CTGGCGAAATGGAGACAGGGAGG + Intergenic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1079542664 11:21594373-21594395 CTGGTGGAGTTGTGAGAAGAGGG + Intergenic
1079548056 11:21659154-21659176 GTGGGGAAATGGAGAGATGTTGG + Intergenic
1079660849 11:23035193-23035215 GTGCTGAAATGGACAGGAGACGG + Intergenic
1079666199 11:23109056-23109078 CTGGAGAAGTGGAGAAAAAAAGG + Intergenic
1079713718 11:23718327-23718349 CTAGTGGAACTGAGAGAAGAGGG + Intergenic
1080083799 11:28254114-28254136 CTGGTAGAATGTAGAGAAAAGGG - Intronic
1080461931 11:32462301-32462323 GAGGGGAACTGGAGAGAAGAGGG - Intergenic
1080788524 11:35498716-35498738 TTTGAGAAATGGAGAGAAGGTGG - Intronic
1080851357 11:36072927-36072949 CTGGTGAAATGGGAAAAATAAGG + Intronic
1080858758 11:36135000-36135022 CAGGGAAAATGGAGAAAAGAAGG - Intronic
1081923803 11:46805540-46805562 ATGGTGAAATGGAAAAAAGTGGG - Intronic
1082841338 11:57692673-57692695 CTGGAGAACTGCAGAGAACACGG - Exonic
1083007548 11:59361799-59361821 GTGGAGAAAGGGGGAGAAGAAGG - Intergenic
1083116773 11:60467722-60467744 TAGGTGAAAAGGAGGGAAGAGGG - Intronic
1083484670 11:62975867-62975889 CTGGTGGAGGGAAGAGAAGAGGG - Intronic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1085169959 11:74441446-74441468 CTGCTTAAAAGGAGACAAGAAGG + Intergenic
1086365139 11:86101346-86101368 CAGGTGAAATGGACAGAAACGGG + Intergenic
1086391915 11:86374344-86374366 TTGGTGACATGTAGAGAAAAGGG + Intergenic
1086620690 11:88884045-88884067 CTAGTGGAATTGTGAGAAGAAGG + Intronic
1086807247 11:91259901-91259923 TTGGTGAAATTTAGTGAAGAAGG + Intergenic
1087552764 11:99672855-99672877 CAGGTGGAAAGGAAAGAAGATGG + Intronic
1087922440 11:103882136-103882158 GTGGAGAAATGGGGAAAAGAGGG - Intergenic
1088024977 11:105168576-105168598 CTTGTGAAATAGAATGAAGATGG - Intergenic
1088554091 11:111043988-111044010 GTAGTGAATTAGAGAGAAGAAGG - Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089069553 11:115688933-115688955 CTGCTGAAATGGACTGAAGAAGG + Intergenic
1090430222 11:126639780-126639802 CTTGTGAAATAGACACAAGAAGG + Intronic
1090531239 11:127593064-127593086 TTGATGAAATGGAGAGGAGGAGG + Intergenic
1090611711 11:128477129-128477151 CTGGTGAAATGGCAGGGAGATGG + Intronic
1090629321 11:128632684-128632706 CTGGAGCAATGCAGACAAGAGGG + Intergenic
1090718212 11:129449352-129449374 ATGGAGTAATGGAGAGAAGCAGG + Intronic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091555344 12:1569306-1569328 CTGGTGAAAAGGAGAGGGAATGG - Intronic
1091770716 12:3149391-3149413 CAGGTAAAAAAGAGAGAAGAAGG - Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1093030414 12:14283515-14283537 CTGGAGAAATGAAGGTAAGAGGG + Intergenic
1093392632 12:18641277-18641299 AGGGTGAAAGGGAGAGATGAAGG - Intronic
1093494812 12:19744099-19744121 TTGGTGGACTGGAGAGATGAAGG - Intergenic
1093757223 12:22866344-22866366 CTGGGGAAAGGAAGAGAATAGGG - Intergenic
1094825271 12:34264668-34264690 TGGGTGAAGGGGAGAGAAGATGG - Intergenic
1096917440 12:55048335-55048357 CTGGGCAAATGGAGAGAGAATGG + Intergenic
1097031841 12:56095366-56095388 GTGGTTACCTGGAGAGAAGAGGG + Intronic
1097331657 12:58338317-58338339 CTGGTGATTTTGATAGAAGAGGG - Intergenic
1097840946 12:64320572-64320594 ATGGTGAGCTGGAGAGAATAGGG - Intronic
1098030815 12:66251911-66251933 ATGCTGAAAGGGTGAGAAGAAGG + Exonic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1100557602 12:95711603-95711625 CTGTTGAACTGGTGAGTAGAAGG + Intronic
1100657608 12:96663290-96663312 GTGAAGAAATGAAGAGAAGAGGG + Intronic
1100662440 12:96714755-96714777 CTGCTGAAAGGGACAAAAGAGGG + Intronic
1100710189 12:97247600-97247622 CTGGTGCAATAGAGAGCACATGG + Intergenic
1101983546 12:109428135-109428157 TTAGTGAAATGAACAGAAGATGG - Intronic
1102357771 12:112253827-112253849 CTTGTGAAAGGGAGTGAACAGGG + Intronic
1103148915 12:118619966-118619988 ATGGTGAACTGAAAAGAAGATGG - Intergenic
1104478104 12:129087120-129087142 TGGGTGACATGGAGAGAGGATGG - Intronic
1104677775 12:130726081-130726103 GTGGTGAGATTGAGAGAAAAGGG + Intergenic
1104715847 12:131015694-131015716 CTGGTCACATGCAGAGAGGAAGG - Intronic
1104959135 12:132479920-132479942 CTGGAGAAATGGGGAGGAAAGGG + Intergenic
1105053586 12:133077825-133077847 ATGGTGAACTGAAGGGAAGAAGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1107795387 13:44046264-44046286 CTAGTGAAAGGAAGGGAAGAGGG + Intergenic
1108058011 13:46504381-46504403 CAGGTGACATGGAGAGACCATGG - Intergenic
1108386574 13:49904638-49904660 CTGGTTACATGGAGACAAGGAGG - Intergenic
1109339775 13:61041053-61041075 ATAGTGAAAGGGAGAGAAAAGGG + Intergenic
1109667564 13:65559006-65559028 CTAGTGAAACTGTGAGAAGAGGG - Intergenic
1109830811 13:67785186-67785208 TTGATGAAAAGGAGACAAGAAGG + Intergenic
1109879345 13:68450938-68450960 CTAGTGAAGTTGTGAGAAGAGGG + Intergenic
1111222332 13:85220796-85220818 CTAGTGAAATTGTGAGAAGAGGG + Intergenic
1111359769 13:87160964-87160986 TGGGAGAAAGGGAGAGAAGAGGG + Intergenic
1111480576 13:88820260-88820282 CTGGTGTAATGGAAAGAAGCCGG - Intergenic
1111520539 13:89396889-89396911 CTGGTGAAATATGGAGAAAAAGG - Intergenic
1111689481 13:91544129-91544151 CTGGTGAAATGTAAATAAGTTGG + Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112170070 13:96962230-96962252 CTGGACCAATGGAGAGAACAGGG + Intergenic
1114320015 14:21539439-21539461 GTGGTGAAGTGGAGAGGGGAGGG + Intergenic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1115083947 14:29490978-29491000 CTTGTTAAAAGGAGACAAGAGGG - Intergenic
1115404669 14:33001216-33001238 CTGGTGAAATGGACAGAAAATGG + Intronic
1115921555 14:38379791-38379813 TTGGGGAAAGGGAGAGAAGGAGG + Intergenic
1116348207 14:43823613-43823635 CTGGTATCATGGAGAGAAAAAGG + Intergenic
1116909083 14:50438778-50438800 TTGGGGAAATGGAGAAAGGAAGG - Intronic
1117158748 14:52966677-52966699 CTGGTGAAATGTGGAGAAAAGGG - Intergenic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117211373 14:53503893-53503915 ATGGACAAATGGAGAGGAGAAGG + Intergenic
1118049011 14:62005597-62005619 CCTGTGAAATGGAAAGAAGTGGG - Intronic
1118329052 14:64801625-64801647 CTGCTGAAGGGGAGAGGAGAAGG + Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119061856 14:71482760-71482782 TGGGTGAGAGGGAGAGAAGATGG - Intronic
1119552180 14:75522952-75522974 CTTGGAAAATGGAGAGAAAAAGG - Intronic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121991133 14:98558692-98558714 CTAGAGAAATGGAGAGAACTTGG - Intergenic
1202946388 14_KI270726v1_random:30752-30774 GTGGTGAAATGGGGAGAGTAAGG + Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124060032 15:26282812-26282834 TTGGTGGAATGTAGAGAAAAGGG - Intergenic
1124376717 15:29133243-29133265 TTGGTAAAGAGGAGAGAAGATGG - Intronic
1124896130 15:33779085-33779107 CTGCTGAACTAGAGAGAAGGAGG - Intronic
1125279078 15:38025440-38025462 CTTGAAAGATGGAGAGAAGAAGG - Intergenic
1125305221 15:38304682-38304704 CTGCTGAAATGAAGACCAGAAGG - Intronic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1126299964 15:47184428-47184450 GAGGAGAAATGGAGAGAAAAGGG - Intronic
1126381365 15:48050887-48050909 CGGGTGGAATGTAAAGAAGATGG - Intergenic
1126522145 15:49606831-49606853 CAAGGGAAATGAAGAGAAGAAGG + Intronic
1126979830 15:54228392-54228414 CTTGAGAAACGGAGAGAAAAGGG - Intronic
1126995556 15:54439914-54439936 GGGGTGAAATGAAGAGAAGTTGG - Intronic
1127431485 15:58914304-58914326 CTGATTAAATGAAGAGAAAAGGG + Intronic
1127537558 15:59904246-59904268 AGGGAGAAATGGAAAGAAGAAGG + Intergenic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1130071365 15:80649129-80649151 CTGGAGCGATGCAGAGAAGATGG + Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130749863 15:86700041-86700063 ATAATGAAATGGGGAGAAGAGGG - Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1131916589 15:97272270-97272292 GAGGTGACAGGGAGAGAAGATGG - Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1133085215 16:3356853-3356875 CTGGGGAAAGGAAGAGAAGTTGG + Exonic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1135425554 16:22332489-22332511 CTAGTGACAAGCAGAGAAGAGGG - Intronic
1135459398 16:22628383-22628405 CAGGGGAAAGGGAGAGACGATGG - Intergenic
1136143546 16:28302186-28302208 CTGGAAAACTGGAGAGAAGGAGG + Intronic
1137501433 16:49014450-49014472 GGGGTGGAATGGGGAGAAGAGGG + Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137554803 16:49463744-49463766 TTGGTGACATTCAGAGAAGAAGG - Intergenic
1137979627 16:53058592-53058614 GTGGTGAAAGGGAGAGAGGCTGG + Intronic
1138717451 16:59040198-59040220 CTGGTATAGTGGAAAGAAGACGG - Intergenic
1139648964 16:68352225-68352247 CTGGTGAATGGGCGAGAAGCAGG - Intronic
1140546324 16:75813350-75813372 CTGGTGAGGTGGGGAGAAAAGGG - Intergenic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1142419382 16:89961100-89961122 GTGGTGGCAGGGAGAGAAGAGGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142859408 17:2751824-2751846 CTCATGAAATGGAGGGAATATGG - Intergenic
1143702091 17:8668232-8668254 TGGGAGAAATGGAGAGAAGATGG - Intergenic
1143737697 17:8924598-8924620 TTGGATTAATGGAGAGAAGACGG - Intronic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1144252394 17:13430831-13430853 CTGGTGTGGTGGAAAGAAGAAGG - Intergenic
1144365647 17:14541890-14541912 ACGGAGAAATGGAGAGAGGAAGG - Intergenic
1144371304 17:14594294-14594316 CAGGAGATATGGATAGAAGAGGG + Intergenic
1146451903 17:32981414-32981436 CTGGTGGAACTGTGAGAAGAGGG - Intronic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147893022 17:43730642-43730664 ATGGGGAAACGGGGAGAAGATGG + Intergenic
1148913524 17:50955915-50955937 CTGCTGAAAGGGAGAAAAGGAGG - Intergenic
1148971964 17:51491465-51491487 ATGGTGAAATGGATAGCACAAGG - Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149375627 17:56041380-56041402 CTGGTGCATTGGAAAGAACAAGG + Intergenic
1150165832 17:62941629-62941651 ATGGTGAAATGGAGAAGAGGTGG + Intergenic
1150179124 17:63096428-63096450 TTGAAGAAATGGAGAGAACATGG + Intronic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1152986606 18:327156-327178 CTGGTGAAATGAGAAGAATAAGG + Intronic
1153976649 18:10274035-10274057 ATGGTGACAGGCAGAGAAGAGGG + Intergenic
1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG + Intronic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1155620663 18:27775144-27775166 TTGGTGAACAGGAGAGAAGTAGG - Intergenic
1155706343 18:28819238-28819260 CTGGCGAAATGCAAAGAAAAAGG - Intergenic
1155936788 18:31762958-31762980 CTGGTGCAAATGAGAGAAGCTGG - Intergenic
1156156312 18:34306941-34306963 CTGGTGAGATGTGGAGAAAAGGG + Intergenic
1156568294 18:38221522-38221544 ATGGGGAAAAGGAGAGAAGGGGG + Intergenic
1156583812 18:38409767-38409789 CTAGTGGAACTGAGAGAAGAGGG + Intergenic
1156706036 18:39883551-39883573 CTGGTGATCTGGTGAAAAGATGG + Intergenic
1157298890 18:46465581-46465603 CTTATGAACTGGAGGGAAGATGG - Intergenic
1157663728 18:49467994-49468016 TTGGTCCAATGGAGAGAAAAAGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158013497 18:52756442-52756464 CTGCTGAAATCCAGTGAAGAAGG - Intronic
1158188361 18:54796984-54797006 TTTCTGAAATGGAGAAAAGACGG - Intronic
1158683059 18:59586265-59586287 TGGTTGAAATGGAAAGAAGAGGG - Intronic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159468298 18:68813817-68813839 CTTTTGAAAGGGAGAGAAGTTGG + Intronic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1159920244 18:74221265-74221287 CAGGTGAGAAGGAGAGAAGGAGG + Intergenic
1159991419 18:74913368-74913390 CTGTTAAAAAGGAGAAAAGAAGG + Intronic
1160058293 18:75507047-75507069 CATGTGGAATGGAGAGAACAGGG + Intergenic
1161848440 19:6725730-6725752 CTGGGAAAATGGAGAGCAGTGGG + Intronic
1161880188 19:6944416-6944438 AGGGAGAAATGGAGAGAAGTAGG + Intergenic
1164456842 19:28415005-28415027 CTGGTGAAATGTGGAGAAAAGGG - Intergenic
1164791681 19:30990942-30990964 TTGCTGAAAGAGAGAGAAGAGGG - Intergenic
1165350182 19:35270835-35270857 GTGTTGAAATGGAAGGAAGAGGG + Intronic
1165361290 19:35338451-35338473 CTGGTTCTAGGGAGAGAAGATGG + Intronic
1165431083 19:35773601-35773623 CTGGTGAAAGGGAGTGCTGAGGG - Intergenic
1165787108 19:38468235-38468257 CTGGTCAGATGGATAGATGATGG - Intronic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1167634212 19:50644612-50644634 GTGGTTGAATGGATAGAAGATGG + Intronic
1167862742 19:52298204-52298226 CTGGTGACAACGAGAGCAGAGGG + Intronic
1167867105 19:52337256-52337278 CTGATGACAAGGAGAGCAGAGGG + Intronic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167960651 19:53102350-53102372 CTGGTGACAAGGCGAGCAGAGGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925526980 2:4813939-4813961 TTGGTGAAACTGTGAGAAGAGGG - Intergenic
926314264 2:11697800-11697822 CTGGTGAGATGGGGAGGAGGGGG - Intronic
926912261 2:17862122-17862144 CTGATGAAATGGCTAGACGAGGG + Intergenic
927185904 2:20482318-20482340 CTGGTCAAAAGAAGAGAAGAAGG - Intergenic
927955650 2:27205651-27205673 CTGGTGATATGTATAAAAGAGGG + Intronic
927962713 2:27250719-27250741 GGGGTGAAATGGAGAGTGGAGGG - Intergenic
928204926 2:29277104-29277126 CTGGCAACATGGAGAGAACAGGG + Intronic
928429433 2:31205497-31205519 CTCCTGAAATGGAGAGAGGACGG + Exonic
928721942 2:34131150-34131172 CTGGTGAAAAGGACCGAATATGG - Intergenic
928766343 2:34651012-34651034 ATGATGCAATGGAAAGAAGAGGG + Intergenic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
929346781 2:40894253-40894275 CTGTTGAAAGGGAAACAAGATGG + Intergenic
929406789 2:41651599-41651621 CTGGTGGAATAAAGAGAGGACGG - Intergenic
929887514 2:45892064-45892086 CTGCTTACATGGAGAGAAGCTGG - Intronic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
930709300 2:54534990-54535012 CTGGTGGAGTGGAGAGAATGAGG - Intronic
931296390 2:60930098-60930120 ATGGAGAAATGGAAAGAATAGGG + Exonic
932876498 2:75457787-75457809 CTGGGGAAATGGGAAGATGAGGG - Intergenic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
933548114 2:83740509-83740531 CTAGTGAAACTGTGAGAAGAAGG - Intergenic
935024164 2:99260467-99260489 AGGGTGAACAGGAGAGAAGAGGG - Intronic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
935784262 2:106534568-106534590 CTGGTGAATTTGACAGAAGGGGG + Intergenic
937043735 2:118839766-118839788 AAGGAAAAATGGAGAGAAGATGG + Intergenic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937800643 2:126077127-126077149 CTAGTGGAGTGGTGAGAAGAGGG + Intergenic
938611604 2:132953273-132953295 ATGGTAAAATGAAGAGCAGAGGG - Intronic
938913520 2:135909583-135909605 TTGTTGGAATGGGGAGAAGATGG - Intronic
939740748 2:145902506-145902528 CTAGTGGAACTGAGAGAAGAAGG + Intergenic
940524073 2:154789841-154789863 ATGGTGCAATGGGGAGAATAAGG + Intronic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
941124821 2:161571966-161571988 TTGATGAAATTGAGAGAAGATGG - Intronic
941126280 2:161587776-161587798 CTGGGGAAATGGGGAGATGGTGG - Intronic
941334981 2:164230819-164230841 CTGGTGAAATGGACAGGGAATGG + Intergenic
941349810 2:164418191-164418213 CTAGTGCAATGTAGACAAGAAGG - Intergenic
941884817 2:170516963-170516985 TTGGAGAAATGGAGATATGAAGG - Intronic
942763144 2:179424043-179424065 CTTGAGAAATGGAGAGAATTAGG - Intergenic
943388415 2:187230935-187230957 GTGATGGAAAGGAGAGAAGATGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
943942412 2:194015344-194015366 CTGGAAAATTGGAGAGAAGGTGG - Intergenic
944253545 2:197601211-197601233 CTTATGAAATGCATAGAAGAAGG - Intronic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
948477280 2:238228113-238228135 CTGGTGAGATGGGGAACAGAAGG + Intronic
1169070518 20:2726038-2726060 CTGGTGAAAGGTAGAAAATAAGG + Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1170440377 20:16373396-16373418 ATGTTTAAATGGAGTGAAGAAGG + Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172261287 20:33568043-33568065 TTGGACAGATGGAGAGAAGACGG + Intronic
1173400394 20:42721320-42721342 ATGGTGAACTGGAGATGAGATGG + Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174731893 20:52925975-52925997 CTGGTGAAATACACAAAAGAAGG - Intergenic
1174981273 20:55397973-55397995 CTGGAGAAAGGAGGAGAAGAAGG - Intergenic
1175262282 20:57682128-57682150 CTGGATAAATGAACAGAAGATGG + Intronic
1175361829 20:58418008-58418030 CTGGTGAAATAGTGGGAACATGG + Intronic
1176529956 21:7950384-7950406 GTGGTGAAGTGGAGAACAGAGGG - Intergenic
1176892536 21:14335499-14335521 GTGGTGAAAAGAAGTGAAGAAGG + Intergenic
1177323863 21:19557636-19557658 CAGGTGAAGTGGAAAGAATATGG + Intergenic
1177476752 21:21633686-21633708 CTAGTGAAACTGTGAGAAGAGGG - Intergenic
1177485463 21:21749549-21749571 AGGGAGAAAGGGAGAGAAGAAGG - Intergenic
1177538235 21:22457804-22457826 CTTGTGAAATAGAGAAAAGTGGG - Intergenic
1177605726 21:23376133-23376155 GTGGTCAAATTGAGAGATGATGG - Intergenic
1178384599 21:32138875-32138897 CTGCTGAGATGGGGAGAAGTGGG + Intergenic
1178455268 21:32744050-32744072 CTGTTTAAATGTAGAGAAGGTGG - Intronic
1178849574 21:36201666-36201688 CTAGTTTAATGGAAAGAAGAAGG - Intronic
1179096727 21:38322836-38322858 CTGCCCAAAAGGAGAGAAGAAGG + Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182599265 22:31447566-31447588 CTGCTGAAAAGGAGAGGGGAGGG + Intronic
1182897888 22:33873819-33873841 CTTGTGACATGGAGTGAGGAGGG - Intronic
1183046095 22:35221447-35221469 CTGGGAAGATGGAGCGAAGAAGG + Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183141191 22:35941518-35941540 CTGGAAAAATGGAAAGAACAGGG - Intronic
1184831414 22:46991138-46991160 TCTGTGAAATGGAGAGAGGAAGG - Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949448775 3:4163727-4163749 CTGGTAAAATTGAAAGAACAGGG - Intronic
949520716 3:4851404-4851426 ATGGTGGAATGGAAAGAACATGG + Intronic
950507840 3:13406765-13406787 CTGCTGAGGTGCAGAGAAGAAGG - Intronic
950806073 3:15604069-15604091 CTGGTGGAACTGTGAGAAGAGGG - Intronic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
951334752 3:21406728-21406750 CTGGTGAAGTGTGGAGAAAAGGG + Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951680626 3:25290826-25290848 CTGGGGAAAGCAAGAGAAGAGGG - Intronic
951983349 3:28589857-28589879 CTGCTGAAATGGAGGAGAGAAGG - Intergenic
951991390 3:28679340-28679362 CAGGAGGAATGGGGAGAAGAGGG - Intergenic
952007928 3:28863836-28863858 CTGGTGAGAGGGAAAGGAGAAGG - Intergenic
952163283 3:30717882-30717904 TTGGTGAAAAAGAGAGAAAAGGG + Intergenic
952214045 3:31258298-31258320 TTGGAGAAATGGAGAGATGTTGG - Intergenic
952735010 3:36680777-36680799 CTGGTGAATCTGTGAGAAGAGGG - Intergenic
953349692 3:42206066-42206088 CTGGAGAAATGGAAAGAAAGAGG + Intronic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
954069324 3:48131319-48131341 CTGGTGTAATGGAAAGGTGAAGG - Intergenic
954294021 3:49664276-49664298 CTAGGGAAATAAAGAGAAGAAGG - Intronic
955078067 3:55632459-55632481 CAGGTGAGATGGAGACAAGGAGG + Intronic
955249224 3:57261902-57261924 TTGGTGAAATGCAGAAAAAAGGG - Intronic
955387931 3:58493826-58493848 TTGGGGAAATGGAGAAAATAAGG - Intronic
955597799 3:60610861-60610883 ATGGTGCAATGATGAGAAGAAGG + Intronic
956932742 3:74063991-74064013 GTAATGACATGGAGAGAAGATGG - Intergenic
957332938 3:78789669-78789691 CTGGTTAACTTGAGAGAACACGG + Intronic
958006079 3:87813092-87813114 CTAGTGAAGTTGTGAGAAGAGGG + Intergenic
959397197 3:105855263-105855285 GGGAAGAAATGGAGAGAAGAAGG + Intronic
960056058 3:113277321-113277343 TTGGTGAAATGCAGAGCTGAAGG + Intronic
960436110 3:117628798-117628820 GTGGTGAGAGAGAGAGAAGAAGG - Intergenic
960465310 3:117990432-117990454 CTTCTGAAATAGAGAAAAGAGGG + Intergenic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961931276 3:130536033-130536055 CTGGAGAAATGGCTAGAATAAGG - Intergenic
962011981 3:131400706-131400728 CCTGTGAAAGGGAGAGAAGCAGG - Intergenic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962339465 3:134569714-134569736 CTGGTGGAACTGTGAGAAGAGGG - Intronic
962630713 3:137272654-137272676 TGGGTGAAGTGGAGAGAAAAGGG + Intergenic
962931350 3:140040506-140040528 CTTGGGAGGTGGAGAGAAGAAGG + Intronic
963275568 3:143326447-143326469 ATGGTGAGAGGGAGAGAAGAGGG - Intronic
963421010 3:145061235-145061257 CTGGTGGAGTTGTGAGAAGAGGG - Intergenic
963497009 3:146077563-146077585 CTTTTTAAAGGGAGAGAAGAGGG - Intronic
964007635 3:151851255-151851277 ATGGAGAAATGGACAGAAGTAGG - Intergenic
964098167 3:152957792-152957814 CATGTGAAATGGTGAAAAGATGG - Intergenic
964164436 3:153685388-153685410 TTGCTGAAATGGAGAAAAGGAGG - Intergenic
964183207 3:153912735-153912757 ATGATGAAATGGAGACAAGGTGG - Intergenic
964256988 3:154786618-154786640 CAGGTGAATGGGAGAGAGGAAGG + Intergenic
965574839 3:170207354-170207376 CTGGTGAAGGGGATAGAATAAGG + Intergenic
965835757 3:172850370-172850392 ATTGAGAAATGGAGAGAAGAAGG + Intergenic
965896621 3:173585113-173585135 CCTGTGAAATGGAGAGAGAAAGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967535547 3:190597998-190598020 TTGGTAAATTGGAGAGAAAAAGG - Intronic
968426884 4:529768-529790 TTTGTGAAATGGAGAGAAAATGG - Intronic
968908574 4:3465457-3465479 CTGGTGTGAGGGAGAGAGGAAGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969338530 4:6526538-6526560 TTGGTGAAAAGAAAAGAAGAGGG + Intronic
969449152 4:7263268-7263290 CTGGTGTAATGGAAGGAAAATGG + Intronic
969936044 4:10682691-10682713 ATGGTGAAATGGAAAGAAACAGG - Intronic
970061552 4:12039582-12039604 CTAGTGAAACTGTGAGAAGAAGG + Intergenic
970583249 4:17492340-17492362 CCTGGGAAATGGGGAGAAGATGG + Exonic
970775382 4:19668662-19668684 ATGGTAAAAGAGAGAGAAGAAGG + Intergenic
971116240 4:23648795-23648817 GTGGGGAAGTGGAGAGAAAATGG - Intergenic
971198469 4:24491597-24491619 CTAGTGAAATGGAGGGAGGGAGG + Intergenic
971753353 4:30678538-30678560 CTAGTGGAGTGGTGAGAAGAGGG + Intergenic
971777494 4:30985451-30985473 CTAGTAAAATGGAAAGAAGATGG + Intronic
971948714 4:33315540-33315562 CTGGTGAAGCTGTGAGAAGAGGG + Intergenic
972056160 4:34805977-34805999 CTAGTGAAACTGTGAGAAGAGGG - Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
974317908 4:60306305-60306327 CTAGTGAAGTTGTGAGAAGAGGG - Intergenic
974469187 4:62296704-62296726 CTAGTGAAACTGTGAGAAGAGGG - Intergenic
975052531 4:69883587-69883609 CTAGTGAAGTTGTGAGAAGACGG - Intergenic
975249169 4:72157368-72157390 CTGCTCAAAAGGAGAGAAAATGG - Intergenic
975823332 4:78293761-78293783 CAGAAAAAATGGAGAGAAGAGGG + Intronic
975917967 4:79347421-79347443 CTAGTGAAATTGTGAGAAGAGGG + Intergenic
977365944 4:96068244-96068266 CTAGTGGAATTGTGAGAAGAAGG - Intergenic
977734437 4:100396367-100396389 CTCATGAAATGTAGAGAAAATGG + Exonic
977784086 4:101012739-101012761 CAGGTAAGGTGGAGAGAAGATGG + Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978602490 4:110443474-110443496 AGGCTGAAAGGGAGAGAAGAGGG - Intronic
979427420 4:120584787-120584809 CTGATGAAATAAATAGAAGAGGG + Intergenic
979490145 4:121316706-121316728 CTGGTGACATGAAGAGGAAATGG + Intergenic
979979463 4:127236881-127236903 CTGGTGAAATGGAGAATGGATGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
981343367 4:143647868-143647890 CTGATTAAACGGTGAGAAGAAGG + Intronic
981424133 4:144584146-144584168 CTGGTGAGAAGGATGGAAGAAGG - Intergenic
981650019 4:147046767-147046789 CTGGTAAATTTGAGAGAACAAGG - Intergenic
981680915 4:147396864-147396886 CTTGTAAACTGGAGAGGAGAAGG + Intergenic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982135448 4:152270581-152270603 CTGGTGAAAAGGAGGCAAGCTGG + Intergenic
982775324 4:159435695-159435717 CAGGTGAGAGGGAGAGAGGAAGG + Intergenic
982903447 4:161037882-161037904 CTGGAGAAATAGAGTGAAGGAGG + Intergenic
983698669 4:170564926-170564948 ATGGTGAAATGGAAAGAGCATGG - Intergenic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
985143085 4:186863176-186863198 CAGGTGCAATGTAGAGAAGTGGG - Intergenic
985215946 4:187654203-187654225 CTGGTGAAATGGGGAGATTTAGG + Intergenic
985856674 5:2433612-2433634 TTGGTGAGATGGTGAGATGATGG + Intergenic
986158294 5:5198937-5198959 GTGGTGAGATGCAGAGAAAAGGG - Intronic
987777402 5:22385849-22385871 CAGGAGAAAGGGAGAGAAGGTGG + Intronic
987867241 5:23560279-23560301 TGGGTGAAAAGGAGAAAAGAAGG - Intergenic
987925621 5:24337041-24337063 GAGGTGAAATGGAGAGGGGAAGG + Intergenic
988065451 5:26225459-26225481 CTGGAGAAATGGGGAGGAGCTGG - Intergenic
989966906 5:50475404-50475426 CTGGTGAAGCTGTGAGAAGAAGG + Intergenic
989995708 5:50827976-50827998 CTGGTGGACTGCTGAGAAGAAGG - Exonic
990317022 5:54592270-54592292 CAGGTGAGATGAAGAAAAGAAGG - Intergenic
990858980 5:60304343-60304365 TTGATGAAATGGAGAGAGAAGGG + Intronic
990925669 5:61019380-61019402 ATAGGGAAAAGGAGAGAAGAGGG - Intronic
991303311 5:65149722-65149744 CTGGTGAAATAAATAAAAGATGG - Exonic
991895122 5:71387788-71387810 TTGGGGAAATGGAGAGATGTTGG - Intergenic
992371388 5:76147577-76147599 CTGGGGAATTTGAGAGTAGAGGG + Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993186281 5:84625426-84625448 CTAGTCAAATGGAGATAATATGG + Intergenic
993750477 5:91659953-91659975 ATGGTGAAATGTGGGGAAGAAGG + Intergenic
994363480 5:98883425-98883447 CTGGTGAAAAAGAAAGAAAACGG + Intronic
994425582 5:99581237-99581259 CAGGGGAAATTGATAGAAGAAGG - Intergenic
994435759 5:99731004-99731026 CAGGGGAAATTGATAGAAGAAGG + Intergenic
995006468 5:107202119-107202141 TTGGTAGAATGTAGAGAAGAGGG - Intergenic
995134741 5:108668954-108668976 CTGGGGAGATGGAGAAAATATGG - Intergenic
995424934 5:112010521-112010543 CTTGTGAAAATGAGAGAAGTGGG + Intergenic
995673634 5:114636519-114636541 GTGGTGAGAGAGAGAGAAGAGGG + Intergenic
995931917 5:117455903-117455925 CTGGTGATGTGGAGACACGAAGG + Intergenic
996444545 5:123530186-123530208 CTTGTGAAATTGAGAATAGAAGG + Intronic
996663915 5:126035743-126035765 ATGGAGAAATGGAGACATGAAGG - Intergenic
996682610 5:126244267-126244289 CTGTTGAAAATGAGAAAAGATGG - Intergenic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997656355 5:135557653-135557675 CTGCTGCAGTGGAGAGAGGATGG + Intergenic
997893953 5:137699292-137699314 TTGGTGAAATGGCGAGAGGTTGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999758529 5:154682887-154682909 CGGGTGGAATGGAGGGAGGAGGG - Intergenic
1001285259 5:170418447-170418469 CTGGAGAAATGATGGGAAGAGGG - Intronic
1001540262 5:172532995-172533017 CTGGTGTAGTGGAGAGAACGCGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002869863 6:1157025-1157047 CTAGTGTAGTGGCGAGAAGAGGG + Intergenic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003221396 6:4164047-4164069 CTGGTGAAATCTAGACATGATGG + Intergenic
1003425813 6:5997477-5997499 CAGCTGAAATGGCGAGGAGACGG - Intergenic
1004005261 6:11632272-11632294 CTGCTGAAATGAAAAGAAAAGGG - Intergenic
1004005604 6:11634658-11634680 CTGCTGAAATGAAAAGAAAAGGG - Intergenic
1005252150 6:23959542-23959564 CTGTTGACAAGTAGAGAAGATGG - Intergenic
1005804873 6:29464898-29464920 CTGCTAAAATGGAGTGAAGAAGG - Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1006802278 6:36766807-36766829 ATGATGAAGTGGAGAGAAGGAGG - Intronic
1007103463 6:39267507-39267529 CTAGAGAAATGGTAAGAAGAGGG - Intergenic
1007986400 6:46211428-46211450 CAGATGACATGGAGAGATGAAGG - Intergenic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1009781732 6:68280089-68280111 CTTGAGAAATGGAGAGGGGAGGG + Intergenic
1009864668 6:69382092-69382114 ATGGTGAAGTTGAGAGAAAAGGG + Intronic
1010594554 6:77748155-77748177 CTAGTGAAGCTGAGAGAAGAGGG - Intronic
1010867407 6:80996069-80996091 CTGGTGAGATGTAGAGAAAAGGG - Intergenic
1010881861 6:81185825-81185847 CTTGGGAAATGGAGAGAATTTGG + Intergenic
1011781903 6:90799045-90799067 ATGGTGGAATGGAAAGAAAATGG - Intergenic
1011806645 6:91079882-91079904 CAGGTGAAAGAGAGAGGAGATGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012686229 6:102253418-102253440 CTGTTCAAAGGGAGAAAAGATGG - Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013177650 6:107691088-107691110 CTGCTGAACTGGAGAGACGATGG + Intergenic
1013204229 6:107932165-107932187 CAGGTCTGATGGAGAGAAGAAGG + Intronic
1013401217 6:109798240-109798262 GTGGTGAAATGGACAGAACTTGG + Intronic
1014402701 6:121010772-121010794 CTGGTGAAAGCTAAAGAAGAGGG - Intergenic
1014664276 6:124217068-124217090 CTGGGAAAATGGTGAGAGGATGG + Intronic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1014882219 6:126737238-126737260 CTTGTGGAATGGAGAGAACAGGG - Intergenic
1015256538 6:131184567-131184589 GGGGTGAAATGGAGGCAAGATGG + Intronic
1015487278 6:133787256-133787278 GTAGTGAAATGGTGAGAAGCAGG - Intergenic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015513697 6:134064048-134064070 CCAGTGCAATGGACAGAAGAGGG + Intergenic
1016136004 6:140543988-140544010 CTGGAGAAAGAGAGAGAAGTGGG - Intergenic
1016208651 6:141501849-141501871 CTTGAGAAATGCAGGGAAGAGGG - Intergenic
1016279725 6:142401729-142401751 GTGGAGAAATGGAGAGAATTTGG + Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1017523359 6:155221482-155221504 CTGTTTCAATGGAGAGAAAAAGG - Intronic
1017651216 6:156584284-156584306 CTGGTGAGATGTGGAGAAAAGGG + Intergenic
1017860521 6:158393370-158393392 CTGGTGAAGCTGTGAGAAGAGGG - Intronic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1018316415 6:162561377-162561399 CTAGTGAGATGCAGACAAGATGG + Intronic
1019327600 7:445986-446008 ATGGAGAGATGGAGAAAAGAAGG + Intergenic
1020431822 7:8123258-8123280 CTGGGGAAATGGAGAGGAAGGGG - Intronic
1020691334 7:11358177-11358199 CAGGTGAAAGGGTGAGAGGAGGG + Intergenic
1020837769 7:13175867-13175889 ATGGTGGATTGAAGAGAAGAGGG + Intergenic
1021089880 7:16471176-16471198 TTGGTGAGATGGAGCAAAGATGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022171797 7:27838607-27838629 CTTGGGTACTGGAGAGAAGAGGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023669397 7:42560325-42560347 CTAGTGGAGTGGTGAGAAGAGGG + Intergenic
1023781900 7:43663722-43663744 ATGGGGAAATGGAGAGTTGATGG - Intronic
1024383496 7:48725300-48725322 CTAGTGGAGTGGTGAGAAGAGGG - Intergenic
1024727739 7:52218762-52218784 TTACTGAAATTGAGAGAAGATGG + Intergenic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1027312888 7:76966166-76966188 CGGGCGGAATGGAGAGAGGAGGG + Intergenic
1027882291 7:83855957-83855979 CTTGAGAACAGGAGAGAAGAGGG + Intergenic
1028295082 7:89119385-89119407 CTGGCCAAATAGAGATAAGAGGG - Intronic
1029126837 7:98300609-98300631 CTCGTGAAATGGAGAAAGGGAGG - Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1029984620 7:104911711-104911733 CAGGAGAAATAGAGAGAATAAGG + Intergenic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030127131 7:106164947-106164969 ATGGTGAAATGGGAATAAGACGG + Intergenic
1030328510 7:108247835-108247857 CTGGAGAAAGGGAGGAAAGAGGG + Intronic
1031444067 7:121829163-121829185 AGGGTGAAGAGGAGAGAAGAGGG - Intergenic
1031608266 7:123794843-123794865 CTGGTGAAGCTGTGAGAAGAGGG + Intergenic
1032859112 7:135860994-135861016 CTTGTGGAGAGGAGAGAAGAGGG + Intergenic
1033450180 7:141455360-141455382 CTGGTGAGATTGGAAGAAGAGGG - Intronic
1033492663 7:141859533-141859555 CTGGTGAGATGGGGAGAGGGTGG + Intergenic
1033518003 7:142128890-142128912 CTAGTGAAGTTGGGAGAAGAGGG + Intronic
1034239525 7:149599115-149599137 CTGGTGAACTGCAGAGCTGAGGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1036078471 8:5526619-5526641 CAGGTGACATTGAGAGAATACGG + Intergenic
1036982927 8:13491299-13491321 GGGGTGGAGTGGAGAGAAGATGG - Intronic
1037888580 8:22608670-22608692 CATGTGAACTGGAGAGAAGACGG - Intronic
1038077386 8:24091605-24091627 CTGGTGAAGTGGAGTGAGCAAGG + Intergenic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1039382777 8:37101342-37101364 CTGATGAAAAGGAGAGAACGTGG + Intergenic
1039382814 8:37101638-37101660 CTTGTGAGATGGAAAGAAAAAGG - Intergenic
1039670836 8:39595867-39595889 TTGGAGAAATGGAAACAAGAAGG - Intronic
1041145016 8:54866136-54866158 ATGGTGAAATGGAAAGAAATTGG + Intergenic
1041224594 8:55685800-55685822 CTTGGGAAATAGAGAGAAGCAGG + Intergenic
1041475106 8:58256224-58256246 GTGTTGAATTGCAGAGAAGAGGG + Intergenic
1041551147 8:59102777-59102799 GTGGTGGAAGGAAGAGAAGAAGG + Intronic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1043599420 8:81919428-81919450 CGGGTGATATAGAGAGAAAATGG - Intergenic
1043959304 8:86397579-86397601 TTAGAGAAATGGAGAGATGAAGG - Intronic
1044009145 8:86970597-86970619 CAGGTGGGAGGGAGAGAAGAGGG - Intronic
1044089127 8:87977530-87977552 CTTGTCCAGTGGAGAGAAGATGG + Intergenic
1044099661 8:88118764-88118786 CTGGTAAAATGGAGCCATGATGG + Exonic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044912255 8:97072690-97072712 CTGGTGAAAAAGACAGAATAGGG - Intronic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1047878047 8:129162103-129162125 ATGATGAGATGGAGAGATGATGG + Intergenic
1048132922 8:131717485-131717507 ATCGTGAAATGGGGAAAAGAAGG + Intergenic
1048139903 8:131784132-131784154 GTTCTGAAATGGAGAGAAGAGGG + Intergenic
1048295390 8:133210086-133210108 CTGGTGAAATGGATGGATGGGGG - Intronic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048706456 8:137158939-137158961 GTGGTAAACTGGAGAGAAGAAGG + Intergenic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1049023940 8:139975773-139975795 CAGGTGACATGAAGAGAGGAGGG - Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049272879 8:141705415-141705437 ATGGAGAGATGGAGAGATGATGG + Intergenic
1049616903 8:143579510-143579532 CTTTTGCAATGGAAAGAAGAGGG + Intergenic
1049700954 8:144012314-144012336 CTGGTGGCATGGAGAGCTGAGGG + Intronic
1050254143 9:3776637-3776659 CTGGAGATATGGTGAGATGAAGG - Intergenic
1050467142 9:5939047-5939069 GACATGAAATGGAGAGAAGAGGG + Intronic
1050520232 9:6489548-6489570 CTGGTGAGATGCAGAGAAACTGG - Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051089102 9:13385383-13385405 CTAGTGGAATTGTGAGAAGAGGG + Intergenic
1051099324 9:13502902-13502924 ATGGGGAAAGGGAGAGAAGCAGG - Intergenic
1051194198 9:14545536-14545558 GGGGAGAAATGGAAAGAAGACGG + Intergenic
1051915270 9:22200181-22200203 CTGCTGAAATGCAGACAAGAAGG - Intergenic
1051968340 9:22857153-22857175 GTGGAAGAATGGAGAGAAGAGGG - Intergenic
1052691883 9:31825835-31825857 GTGGTAAAAGGGATAGAAGAAGG - Intergenic
1053047478 9:34931863-34931885 CTGGTGAAAGTGGGAAAAGAGGG + Intergenic
1055084554 9:72300775-72300797 CTGGGCAAATGGGGAGAAAAAGG + Intergenic
1057569199 9:96190980-96191002 TTGGTGAGTTGGAGAGAGGAAGG - Intergenic
1058305202 9:103432924-103432946 CAGAAGAAATGGAGAAAAGATGG - Intergenic
1058909857 9:109511164-109511186 CTGGTGTAAAGGAGATGAGAAGG - Intergenic
1059468255 9:114483382-114483404 TTGTAGAAATGGAGACAAGAAGG - Intronic
1059819925 9:117960971-117960993 TTGAGGAAATGGAGAGAAAATGG - Intergenic
1061182331 9:129032035-129032057 GAGGTGAACTGGAGAGGAGATGG - Intergenic
1061568698 9:131462051-131462073 CTGGTGAAAAGGAAAAAAAAAGG - Intronic
1061921533 9:133785159-133785181 CTGGTGAAATGGAGAGGGGAAGG - Intronic
1062259849 9:135656072-135656094 CTGGGGAACTTGACAGAAGAGGG + Intergenic
1203387210 Un_KI270438v1:66718-66740 GTGGTGAAGTGGAGAACAGAGGG + Intergenic
1185648105 X:1629388-1629410 CAGGTGAGATGGAGCCAAGAAGG - Intronic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1187452858 X:19413853-19413875 AAGGGGAAAAGGAGAGAAGAAGG + Intronic
1187619109 X:21030571-21030593 CTAGTGGAATTGTGAGAAGAAGG - Intergenic
1187984662 X:24797217-24797239 CAGGGGAAATGGAGAGAGGGTGG - Intronic
1188009828 X:25043808-25043830 CTGGTCAAATGGCGAGAGGCAGG + Intergenic
1188295874 X:28447631-28447653 CTGGTGAGATTGGGAGAAAAGGG + Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1188563164 X:31493376-31493398 CTGGTCAAATGTAGACAACAGGG + Intronic
1188674126 X:32917619-32917641 CTGGGGAAAAAAAGAGAAGAAGG + Intronic
1188873600 X:35403306-35403328 ATGGTGAAATGGAGGGAGGCTGG - Intergenic
1189442058 X:41046125-41046147 CTGGTAAAATGGAATTAAGATGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1192420772 X:71028244-71028266 GTGGTAAAATAGAGAGAGGATGG + Intergenic
1193722400 X:85002922-85002944 CTGGAGGAATTTAGAGAAGAGGG - Intergenic
1193969339 X:88032503-88032525 CTGGTGAGGTGCAGAGAAAAGGG + Intergenic
1194470896 X:94295607-94295629 CTCAAGAAATGGAGAGAAGGAGG + Intergenic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1195130111 X:101842898-101842920 GTGGGGAAAGGGAGAGAAGGTGG + Intronic
1195351430 X:104000181-104000203 CTGGTGAACTGCACATAAGAGGG - Intergenic
1195937652 X:110140902-110140924 CTTGTAAAATGGGGAAAAGAGGG + Intronic
1196768152 X:119268362-119268384 GGGGTGAGATGGAGAGAACAAGG - Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199034393 X:143033230-143033252 CTGGAGAAAATGAGAGAATAAGG + Intronic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199265484 X:145821842-145821864 CTGGTGGACTGCAGAGGAGAGGG + Exonic
1199878651 X:151955202-151955224 CTGATGTAATGGTGAGAAGTTGG - Intronic
1199986096 X:152952704-152952726 GTGGTGAAAAGAAGGGAAGAGGG + Intronic
1200218069 X:154377417-154377439 CTGGTGACAAGGGAAGAAGAGGG - Intergenic
1202379274 Y:24261556-24261578 GGGGAGAAAGGGAGAGAAGAAGG - Intergenic
1202491508 Y:25408565-25408587 GGGGAGAAAGGGAGAGAAGAAGG + Intergenic