ID: 913539894

View in Genome Browser
Species Human (GRCh38)
Location 1:119808714-119808736
Sequence CTGAGCTGCCTGGCCAAAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913539894_913539899 28 Left 913539894 1:119808714-119808736 CCTGTTTTGGCCAGGCAGCTCAG 0: 1
1: 0
2: 1
3: 16
4: 212
Right 913539899 1:119808765-119808787 GCCATCTTCCTCCTACCCTGAGG 0: 1
1: 0
2: 2
3: 27
4: 280
913539894_913539897 3 Left 913539894 1:119808714-119808736 CCTGTTTTGGCCAGGCAGCTCAG 0: 1
1: 0
2: 1
3: 16
4: 212
Right 913539897 1:119808740-119808762 TAGGAGCAGCCGCATGCTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913539894 Original CRISPR CTGAGCTGCCTGGCCAAAAC AGG (reversed) Exonic
900575057 1:3378974-3378996 CTGAGATGCCTGACCACATCTGG - Intronic
901175629 1:7296877-7296899 TTTAGCTGCCTGGACAAAAAGGG + Intronic
901676880 1:10890571-10890593 CTGGGCTGCCTGGCCAGGCCTGG - Intergenic
902443053 1:16443797-16443819 CTGAGCAGCCTGGCCAGACCAGG - Intronic
904091628 1:27949024-27949046 CTGAGTTGCCTGCCCCAAATTGG + Intronic
905802835 1:40856373-40856395 CAGTGCTGCCTGGCCAAAGTGGG - Intergenic
906237934 1:44223029-44223051 CTGACTTGCCTGCCCAAAGCAGG - Intronic
906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG + Intronic
906638330 1:47425341-47425363 CTGGGCAGCCTGGCCAGAGCTGG + Intergenic
907386021 1:54125765-54125787 CTGAGCACCCTGGCCCCAACTGG - Intergenic
908127728 1:61047904-61047926 GAGACCTGTCTGGCCAAAACAGG - Intronic
908233254 1:62126481-62126503 CTGTGCTGCCATGCCAGAACTGG + Intronic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
915224623 1:154403539-154403561 GTGAGCTGCCAGCCTAAAACAGG - Intergenic
915284170 1:154842340-154842362 CAGAGCTGTCTGGCCAAGACAGG + Intronic
915490636 1:156248231-156248253 CTGTGCTGACTGGCTAGAACAGG + Intergenic
919635597 1:200000325-200000347 GAGAGCAGCCTGGCCAACACGGG - Intergenic
920511454 1:206555436-206555458 CTTAGCTGGCTGGACAAAGCAGG + Intronic
922339378 1:224643435-224643457 CTGGGCTGCGGGGCCAAAGCAGG - Intronic
924443998 1:244111561-244111583 CTGAGCTCCCTGCCCAAATCAGG + Intergenic
1062819348 10:522575-522597 CCCAGCAGCCTGGCCAAAACTGG - Intronic
1064751647 10:18536547-18536569 CTGCCATGCCTGGCCAGAACTGG + Intronic
1065121035 10:22530571-22530593 CTGAGCTGCAAGCACAAAACCGG - Intergenic
1066581142 10:36883733-36883755 CAGAGCTGCCACGCCAAACCTGG - Intergenic
1066758425 10:38732646-38732668 CAGAGCAGCCTGGCCAACATAGG - Intergenic
1066963232 10:42240048-42240070 CAGAGCAGCCTGGCCAACATAGG + Intergenic
1069223033 10:65907264-65907286 ATGGGGTGGCTGGCCAAAACAGG - Intergenic
1069235770 10:66070813-66070835 ATGAGCTCCCTGTCCACAACAGG - Intronic
1070186716 10:74070687-74070709 CTGAGCTGCCTGGACAAGCTTGG - Exonic
1070585406 10:77762035-77762057 CTGAGCTGCGCAGCCAAAGCAGG + Intergenic
1074460832 10:113635625-113635647 CAGACCAGCCTGGCCAACACGGG - Intronic
1074627558 10:115208735-115208757 CTGATCTGCATGTGCAAAACGGG - Intronic
1077413309 11:2413440-2413462 GTGAGCTGCCCGGCCAGGACAGG - Intronic
1077477643 11:2797909-2797931 CTGGGCTGCCTGGGCCAACCTGG - Intronic
1078698449 11:13658472-13658494 CTGAGATCCCTGGGAAAAACAGG - Intergenic
1079176194 11:18143579-18143601 CTGACCTGCCTGGCCCACTCTGG - Intronic
1079349244 11:19678776-19678798 ATCAGCTGCCTGGCCAATCCGGG - Intronic
1082999670 11:59279964-59279986 CTGAACTGCCTGTCATAAACTGG + Intergenic
1083994181 11:66264064-66264086 CTGAGCTGCTTGGCCACATCTGG - Exonic
1085405019 11:76256615-76256637 CTGGGCTGCCTGGCCTAATGGGG + Intergenic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1085758355 11:79220136-79220158 CTGGGCTGCCTTCCCTAAACAGG - Intronic
1086174232 11:83870802-83870824 CAGATCTGCCTAGCCAAACCCGG - Intronic
1087169183 11:95033080-95033102 CTGAGATGCCTGGCTGAAAGGGG + Intergenic
1087293122 11:96341021-96341043 CAGAGCTGGCTGGCCAAAGCTGG + Intronic
1089667816 11:120031535-120031557 CTGAGCTGCCTAGGGAACACAGG - Intergenic
1090069904 11:123534958-123534980 CTGAGCAGCCTGGTCAGGACAGG + Intronic
1091681618 12:2531610-2531632 CTCTGCTGCCTGGCCAAGATGGG - Intronic
1093125538 12:15323242-15323264 CTGAGCTCCCTGGACACAAATGG + Intronic
1095554481 12:43483771-43483793 CTGAGATGTCTGCCCAACACTGG + Intronic
1096019023 12:48306827-48306849 CAGAGCAGCCTGGGCAACACAGG + Intergenic
1098284964 12:68897534-68897556 CAGAGCAGCCTGGCCAATATGGG + Intronic
1099128259 12:78794025-78794047 CAGAGCTGCCTTGCCCACACCGG + Intergenic
1099202565 12:79692125-79692147 ATGTGCTACCTGGGCAAAACAGG - Intergenic
1100410118 12:94308439-94308461 TTGAGATGCTTGGCCATAACAGG - Exonic
1101871110 12:108566251-108566273 CTGAGCTTCCTGGCCCACAGGGG - Intronic
1103396536 12:120611533-120611555 CTGAACTGCCTGTCAAGAACTGG + Intergenic
1103728764 12:123012483-123012505 CTGACCTGCCTGCCCAGGACAGG + Intronic
1104619619 12:130301481-130301503 CTGAGCTCCCTGCCCAACACAGG + Intergenic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1113523131 13:110954508-110954530 CTGAACTTCCTGGCCAACTCTGG + Intergenic
1113702233 13:112396301-112396323 CTGAACTTCCTGGCCAACTCTGG - Intronic
1113703052 13:112401909-112401931 CTGTGCTGCATGGCCCAGACAGG - Intronic
1114452232 14:22834946-22834968 CTTGACTGCCTGGCCAAAACTGG - Exonic
1115641177 14:35336673-35336695 CTGAGCCGCCAGCCCAGAACGGG + Intergenic
1116625703 14:47260161-47260183 CTGACCTGCCTGGAGAAAATGGG + Intronic
1118055405 14:62074457-62074479 CTTACCTGCCTGGCCTGAACTGG - Intronic
1119725427 14:76919310-76919332 AGGAGCTGCCTGGCCCAAGCAGG + Intergenic
1122100729 14:99407687-99407709 CTGAGAAGCCAGGCCACAACAGG - Intronic
1122272860 14:100576148-100576170 CAGAGCTGCCTGGCCCCAGCTGG + Intronic
1123441835 15:20297362-20297384 CAGAGCAGCCTGGCCAACATAGG - Intergenic
1123791302 15:23723525-23723547 CAGACCTGCCTGGCCAAACATGG + Intergenic
1124086226 15:26552797-26552819 ATGAGCTGCCTGGCTCACACTGG + Intronic
1124170756 15:27370578-27370600 CTGAGATTCCAGGGCAAAACAGG - Intronic
1124558151 15:30746824-30746846 GAGGGCAGCCTGGCCAAAACGGG - Intronic
1127329295 15:57923019-57923041 CTGGGCTGCTTGCCCAAATCTGG - Intergenic
1127878924 15:63138838-63138860 CTGACCAGCCTGGCCAACATAGG + Intronic
1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG + Intergenic
1129111145 15:73338023-73338045 CTGAGCTGCCTGGGAAGAGCTGG + Intronic
1129814267 15:78538343-78538365 CTAAGCTGCCTGGTTACAACTGG + Intergenic
1132799376 16:1744152-1744174 GTGAGCTCACAGGCCAAAACTGG - Intronic
1133021889 16:2970383-2970405 CTGAGCGGCCTGGCCCAGCCTGG + Intronic
1136719373 16:32308151-32308173 CAGAGCAGCCTGGCCAACATAGG + Intergenic
1136837745 16:33514431-33514453 CAGAGCAGCCTGGCCAACATAGG + Intergenic
1136842725 16:33552590-33552612 CAGAGCAGCCTGGCCAACATAGG + Intergenic
1139595324 16:67954440-67954462 CTGCCTTGCCTGGCCCAAACTGG + Intronic
1140447534 16:75043182-75043204 CTAAGCAGCCTGGCCAAGTCTGG + Intronic
1140701582 16:77586542-77586564 CTGAGCTGCCTTCCTAAAACAGG - Intergenic
1203007058 16_KI270728v1_random:209618-209640 CAGAGCAGCCTGGCCAACATAGG - Intergenic
1203147925 16_KI270728v1_random:1814717-1814739 CAGAGCAGCCTGGCCAACATAGG + Intergenic
1203152890 16_KI270728v1_random:1852888-1852910 CAGAGCAGCCTGGCCAACATAGG + Intergenic
1142571487 17:877799-877821 CTGGCCTGCCTGGTGAAAACCGG - Intronic
1145912531 17:28551004-28551026 CTGAGCTCCCTTGCCCAAGCAGG - Intronic
1146798101 17:35797031-35797053 CAGAGCTCCCTGCCCAAAGCAGG + Intronic
1146859025 17:36280266-36280288 GAGAGCAGCCTGGCCAAAATGGG - Intronic
1147089347 17:38084352-38084374 GAGAGCAGCCTGGCCAAAATGGG - Intergenic
1147107864 17:38236166-38236188 GAGAGCAGCCTGGCCAAAATGGG + Intergenic
1148421529 17:47551667-47551689 GAGAGCAGCCTGGCCAAAATGGG - Intronic
1149475334 17:56956453-56956475 GTGAGCAGCCTGGGCAACACAGG - Intronic
1150127677 17:62648887-62648909 TTGAGCTCGCTGCCCAAAACTGG + Intronic
1151308652 17:73280086-73280108 CTGTGCTGCTTGGCCAAGCCAGG + Intergenic
1152626427 17:81389885-81389907 CTGACCTGGTTGGACAAAACCGG + Intergenic
1152662502 17:81549274-81549296 CTGAGATGCCTGGCCCAGCCAGG - Exonic
1153142889 18:1995163-1995185 CCCAGCTGCCTGGCTAAATCAGG - Intergenic
1154280081 18:12994947-12994969 CTGAGATGCCTGGCCATGAAGGG + Intronic
1157927110 18:51778690-51778712 GTGAGCTGCTTGGTCAAAGCAGG + Intergenic
1162009717 19:7805056-7805078 CAGAGCTCCCTGGCAAAGACTGG - Intergenic
1162843029 19:13370298-13370320 GAGACCTGCCTGGCCAAAATGGG - Intronic
1162884499 19:13686262-13686284 CAGACCAGCCTGGCCAACACGGG + Intergenic
1163276793 19:16289819-16289841 TTGAGCTGCCAGGCCACAGCTGG - Intergenic
1163548560 19:17952741-17952763 CTGCGCAGCCTGGCCAGCACAGG - Intronic
1166782408 19:45349447-45349469 TTGAGCTGCTTGGCCACATCTGG - Exonic
1167031217 19:46962332-46962354 CTGGCCTGCCTTGCCAAGACTGG + Intronic
1167374133 19:49102226-49102248 CTGAGCTGCCTGGCTAAGCTGGG - Intronic
1167488395 19:49776739-49776761 CTGGGCTCCCTGGCCATCACGGG + Intronic
928217779 2:29376718-29376740 CCTAGCAGCCTGGCCCAAACTGG - Intronic
931235493 2:60409379-60409401 CTGCCCTGCCTGCCCTAAACCGG - Intergenic
932122928 2:69118209-69118231 CAGAGCTGCCTGGGCAACATAGG + Intronic
934321739 2:91977087-91977109 CAGAGCAGCCTGGCCAACATAGG - Intergenic
936059433 2:109284695-109284717 ATGATCTGCCTGGCCTAGACTGG - Intronic
938176437 2:129135494-129135516 CTGAGTTGTCTGGCAAATACTGG - Intergenic
940033524 2:149289374-149289396 CTTAGCTGCCTGTCAAAATCTGG - Intergenic
941747216 2:169099504-169099526 CAGAGCAGCCTGGACAACACAGG + Intergenic
941775309 2:169387050-169387072 CTGTGCTGCTTTGCCAAAGCTGG + Intergenic
944811537 2:203331556-203331578 CAGACCAGCCTGGCCAAAATGGG - Intronic
948892775 2:240915389-240915411 CTCAGCTGCCTGCCCCCAACTGG - Intergenic
1170871120 20:20207517-20207539 CTGAGCTCCCAGGCAGAAACTGG + Intronic
1171226145 20:23443634-23443656 CTGGGTTGCCTGGCCACCACAGG - Intronic
1171963883 20:31515072-31515094 CTGATCTGCCTGGGCCCAACAGG - Intronic
1172486394 20:35300544-35300566 CTGAGCTTCCTGGTCAAAGGTGG - Intergenic
1173001428 20:39108657-39108679 CAGTCCAGCCTGGCCAAAACTGG - Intergenic
1173945106 20:46944196-46944218 AGGACCTGCTTGGCCAAAACAGG - Intronic
1180548487 22:16522854-16522876 CAGAGCAGCCTGGCCAACATAGG - Intergenic
1181718124 22:24750289-24750311 CTGCCCTGGCTGGCCAAAAGTGG + Intronic
1181766109 22:25093251-25093273 CTAGGCTGCCTGCTCAAAACTGG - Intronic
1182210971 22:28677445-28677467 CAGAGCAGCCTGGCCAACATAGG + Intronic
951608430 3:24463467-24463489 AAGAGCTGCCTGGGCAACACAGG - Intronic
952223450 3:31349188-31349210 CTGACCAGCCTGGGCAACACAGG + Intergenic
952411717 3:33055352-33055374 ATGAGAAGCCTGGCCAAAGCAGG + Intronic
952467364 3:33603820-33603842 CTGACCAGCCTGGCCAACATGGG - Intronic
954431344 3:50472450-50472472 TAGAGCTGCCTGGCCAGAGCTGG - Intronic
954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG + Intronic
956506006 3:69940792-69940814 CTAAACTGCCTGCCCTAAACAGG - Intronic
956681969 3:71789392-71789414 CAGACCAGCCTGGACAAAACAGG + Intergenic
957063740 3:75503997-75504019 CGGAGCTGCCGGGTCAAAAGGGG + Intergenic
958020870 3:87994326-87994348 CTGAGTTGACAGGCCAAAGCTGG + Intergenic
961077170 3:123992762-123992784 CTGAGATGCCTGGGGACAACAGG + Intergenic
961307405 3:125968538-125968560 CTGAGATGCCTGGGGACAACAGG - Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962693744 3:137927357-137927379 CAGGGCTTTCTGGCCAAAACTGG + Intergenic
969290032 4:6232971-6232993 CTGAGCCGCCTGGCCCAGGCTGG - Intergenic
969618844 4:8268999-8269021 CTGGGCTGCCTGGCGAAGCCTGG - Intergenic
969887561 4:10229177-10229199 CTGAGCTGGCTGTCATAAACTGG + Intergenic
970274275 4:14380954-14380976 GAGACCAGCCTGGCCAAAACAGG + Intergenic
970372938 4:15426702-15426724 CTGAGCTCCCTGGCAGAGACTGG + Intronic
971277344 4:25210848-25210870 CAAAGCTCACTGGCCAAAACCGG - Intronic
971277589 4:25212754-25212776 CAAAGCTCACTGGCCAAAACAGG - Intronic
972420778 4:38884186-38884208 CAGACCTGCCTGGGCAACACAGG - Intronic
972830170 4:42805805-42805827 GTGAGCTACCTGGCCAAACCAGG - Intergenic
973098063 4:46226844-46226866 CTGAGCTGCCTGTCATGAACTGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
975661008 4:76689302-76689324 CTGAGCTCCCGGGCCAATCCGGG + Intronic
977323375 4:95547605-95547627 CTGAGCTGCCTCGCCTGAGCCGG + Intronic
978427445 4:108597055-108597077 AAGACCAGCCTGGCCAAAACAGG + Intergenic
979170072 4:117590542-117590564 CTCACCTACCTGGCCAAAAAGGG - Intergenic
981026895 4:140085613-140085635 CAGAGCTGCTTGGCCAAAACGGG + Intronic
981746509 4:148057405-148057427 CTGTGCTGTCTTGTCAAAACAGG + Intronic
982386600 4:154811878-154811900 GTGACCAGCCTGGCCAACACAGG - Intronic
982597768 4:157406943-157406965 CTGAACTGCCTGTCATAAACTGG - Intergenic
984169075 4:176339559-176339581 CTGATCCGCCTGGCCAAATTTGG - Intergenic
986088403 5:4477230-4477252 TTGAGCTTCCTGGACAAAAAGGG + Intergenic
987225635 5:15838145-15838167 CTGAGCTGCCTGGGACAACCTGG - Intronic
991423228 5:66463060-66463082 CTGAGTGACCTGGCCAAATCAGG + Intergenic
996410229 5:123151139-123151161 CTCAGCTGCTTGGCGAAAACTGG + Intronic
999901544 5:156091412-156091434 CTGAGCTACCTGGCCTAACCAGG - Intronic
1001232798 5:170003910-170003932 CAGAGCCCCATGGCCAAAACTGG + Intronic
1001241745 5:170076573-170076595 CTGAGCTCCTTGGCCTAAAGAGG + Intronic
1001260060 5:170220689-170220711 CTCAGCTGGCTGGCCAACCCTGG + Intergenic
1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG + Intronic
1001682584 5:173569785-173569807 CTGAGCTTCCTGGGCAAGCCCGG + Intergenic
1002301161 5:178257838-178257860 CTCAGCTGCCTGGCCCACAGGGG - Intronic
1004488870 6:16094719-16094741 GTGGGCTGCCAGACCAAAACTGG + Intergenic
1004654390 6:17644741-17644763 CTGACCAGCCTGGCCAAACGTGG + Intronic
1010065855 6:71681727-71681749 CTAAGCTCACTGGCCAAATCTGG - Intergenic
1012108558 6:95197652-95197674 CTGAGCTACCTGTCATAAACTGG - Intergenic
1014587947 6:123224267-123224289 AAGAGCTGTCTGACCAAAACAGG + Intronic
1016776613 6:147911466-147911488 CTGAGCTACAAAGCCAAAACTGG + Intergenic
1021713891 7:23443464-23443486 CTGACCAGCCTGGCCAACATTGG + Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1023833508 7:44054390-44054412 CAGACCAGCCTGGCCAACACAGG - Intronic
1023992639 7:45138343-45138365 CAGACCAGCCTGGCCAACACGGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026774206 7:73220985-73221007 CTGGGCTGCCTGGCCATGGCAGG - Intergenic
1027015063 7:74774371-74774393 CTGGGCTGCCTGGCCATGGCAGG - Intronic
1027072968 7:75171582-75171604 CTGGGCTGCCTGGCCATGGCAGG + Intergenic
1031767836 7:125803782-125803804 CTGAGCTGCCTGTCATGAACTGG + Intergenic
1032693952 7:134317042-134317064 CGGAGCTGCCTGGCGGAAGCGGG - Exonic
1033742315 7:144284601-144284623 CGGTGCTGCCTGGCCACAGCGGG + Intergenic
1033751587 7:144365013-144365035 CGGTGCTGCCTGGCCACAGCGGG - Exonic
1034140364 7:148810022-148810044 CTGAGCTGCCTGAACACAAGAGG + Intronic
1034466356 7:151232341-151232363 CCGGGCTGCCTGGCCCCAACCGG - Intergenic
1034589630 7:152128580-152128602 CAGAGCAGCCTGGCCAACATGGG + Intergenic
1036495790 8:9268707-9268729 CTGTGCTGCCTGTCCAACTCAGG - Intergenic
1039872065 8:41554527-41554549 GAGAGCAGCCTGGCCAACACAGG - Intergenic
1042602838 8:70515445-70515467 CAGATCTCTCTGGCCAAAACTGG + Intergenic
1044551379 8:93516405-93516427 CTGACTTGCCTGGACTAAACAGG - Intergenic
1044736679 8:95286035-95286057 CACATCTGCCTGGTCAAAACTGG - Intergenic
1047760282 8:127949477-127949499 CTGAGCTCCCTCCCAAAAACAGG - Intergenic
1049615242 8:143573037-143573059 CTGAGCTCCCTGGTCAACAGGGG - Intergenic
1050215672 9:3320351-3320373 GAGACCAGCCTGGCCAAAACAGG + Intronic
1058766481 9:108187235-108187257 CTGAGCTGATTGGCCAAGCCTGG + Intergenic
1059425621 9:114219193-114219215 CTGAGCTGCCCGGCCCAGGCAGG - Intronic
1060443107 9:123660156-123660178 CTGGGCTCCCTGTCTAAAACGGG + Intronic
1061216245 9:129223676-129223698 CTGAGCCGCCTGCCCAGAGCCGG + Intergenic
1186591912 X:10939633-10939655 CTGAGCTGAATGACCAAATCTGG - Intergenic
1187975116 X:24697143-24697165 CAGAGCTGCCTGTCCAAAAGAGG - Intronic
1189151853 X:38717407-38717429 CTGAAATGCTTGGCCAGAACAGG - Intergenic
1190132976 X:47768362-47768384 CTGGGCTTCCTGGCAAAAGCAGG + Intergenic
1192059346 X:67807431-67807453 CTGAGCTGCCTATCAGAAACTGG - Intergenic
1192437946 X:71154287-71154309 CTGAGCTGCCTGGCCCCTTCGGG - Intronic
1192557897 X:72105098-72105120 CCCAGCTGCCTGGCCTCAACTGG - Intergenic
1194052155 X:89082536-89082558 CTGACCTGCCTGACCAATTCAGG - Intergenic
1196755844 X:119156386-119156408 CTCAGCTGCCTGGCCAAGGAAGG - Intergenic
1198327990 X:135593349-135593371 CTGAGCTGCCTATCCTAACCAGG + Intergenic
1198339164 X:135697562-135697584 CTGAGCTGCCCATCCTAAACAGG - Intergenic
1198812774 X:140552359-140552381 CAGAGCAGCCTGGGCAACACAGG - Intergenic
1199980511 X:152917993-152918015 CTGGGCTGTGTGGCCAAATCTGG + Intronic
1200093443 X:153646609-153646631 CTGAGCTCCCAGCCCTAAACTGG - Intronic
1201189228 Y:11432209-11432231 CGGAGCAGCCTGGCCAACATAGG - Intergenic