ID: 913543574

View in Genome Browser
Species Human (GRCh38)
Location 1:119844637-119844659
Sequence TGAAGGATCTTAAAGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913543574_913543575 -9 Left 913543574 1:119844637-119844659 CCACAGCACTTTAAGATCCTTCA No data
Right 913543575 1:119844651-119844673 GATCCTTCACCACAAAAACAAGG No data
913543574_913543579 20 Left 913543574 1:119844637-119844659 CCACAGCACTTTAAGATCCTTCA No data
Right 913543579 1:119844680-119844702 GTGCCTGAGCTCAGAGCTGAAGG No data
913543574_913543577 -2 Left 913543574 1:119844637-119844659 CCACAGCACTTTAAGATCCTTCA No data
Right 913543577 1:119844658-119844680 CACCACAAAAACAAGGTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913543574 Original CRISPR TGAAGGATCTTAAAGTGCTG TGG (reversed) Intergenic
No off target data available for this crispr