ID: 913546160

View in Genome Browser
Species Human (GRCh38)
Location 1:119871213-119871235
Sequence GGTCACACCATTCCAGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913546156_913546160 -4 Left 913546156 1:119871194-119871216 CCAGAGGTTCCTGACTTTTGGTC No data
Right 913546160 1:119871213-119871235 GGTCACACCATTCCAGGGAGCGG No data
913546154_913546160 5 Left 913546154 1:119871185-119871207 CCTGCGTATCCAGAGGTTCCTGA No data
Right 913546160 1:119871213-119871235 GGTCACACCATTCCAGGGAGCGG No data
913546153_913546160 6 Left 913546153 1:119871184-119871206 CCCTGCGTATCCAGAGGTTCCTG No data
Right 913546160 1:119871213-119871235 GGTCACACCATTCCAGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913546160 Original CRISPR GGTCACACCATTCCAGGGAG CGG Intergenic
No off target data available for this crispr