ID: 913546296

View in Genome Browser
Species Human (GRCh38)
Location 1:119872075-119872097
Sequence TGTGCCTAACAGCCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913546292_913546296 11 Left 913546292 1:119872041-119872063 CCGGACACCATTACATGAATGAC No data
Right 913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG No data
913546293_913546296 4 Left 913546293 1:119872048-119872070 CCATTACATGAATGACCACAGCC No data
Right 913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG No data
913546287_913546296 20 Left 913546287 1:119872032-119872054 CCCATGCCCCCGGACACCATTAC No data
Right 913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG No data
913546289_913546296 14 Left 913546289 1:119872038-119872060 CCCCCGGACACCATTACATGAAT No data
Right 913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG No data
913546288_913546296 19 Left 913546288 1:119872033-119872055 CCATGCCCCCGGACACCATTACA No data
Right 913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG No data
913546291_913546296 12 Left 913546291 1:119872040-119872062 CCCGGACACCATTACATGAATGA No data
Right 913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG No data
913546290_913546296 13 Left 913546290 1:119872039-119872061 CCCCGGACACCATTACATGAATG No data
Right 913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913546296 Original CRISPR TGTGCCTAACAGCCACAAAC TGG Intergenic
No off target data available for this crispr