ID: 913549990

View in Genome Browser
Species Human (GRCh38)
Location 1:119907800-119907822
Sequence CAACTCTACTGCTCTAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913549990_913549996 23 Left 913549990 1:119907800-119907822 CCCATTCTAGAGCAGTAGAGTTG No data
Right 913549996 1:119907846-119907868 TGTTAGTTTTAAGGTCCTCAAGG No data
913549990_913549994 14 Left 913549990 1:119907800-119907822 CCCATTCTAGAGCAGTAGAGTTG No data
Right 913549994 1:119907837-119907859 AGCTTCCTATGTTAGTTTTAAGG No data
913549990_913549993 -10 Left 913549990 1:119907800-119907822 CCCATTCTAGAGCAGTAGAGTTG No data
Right 913549993 1:119907813-119907835 AGTAGAGTTGTATGGTCTTCAGG No data
913549990_913549998 30 Left 913549990 1:119907800-119907822 CCCATTCTAGAGCAGTAGAGTTG No data
Right 913549998 1:119907853-119907875 TTTAAGGTCCTCAAGGGTCGAGG No data
913549990_913549997 24 Left 913549990 1:119907800-119907822 CCCATTCTAGAGCAGTAGAGTTG No data
Right 913549997 1:119907847-119907869 GTTAGTTTTAAGGTCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913549990 Original CRISPR CAACTCTACTGCTCTAGAAT GGG (reversed) Intergenic
No off target data available for this crispr