ID: 913549991

View in Genome Browser
Species Human (GRCh38)
Location 1:119907801-119907823
Sequence ACAACTCTACTGCTCTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913549991_913549996 22 Left 913549991 1:119907801-119907823 CCATTCTAGAGCAGTAGAGTTGT No data
Right 913549996 1:119907846-119907868 TGTTAGTTTTAAGGTCCTCAAGG No data
913549991_913549994 13 Left 913549991 1:119907801-119907823 CCATTCTAGAGCAGTAGAGTTGT No data
Right 913549994 1:119907837-119907859 AGCTTCCTATGTTAGTTTTAAGG No data
913549991_913549997 23 Left 913549991 1:119907801-119907823 CCATTCTAGAGCAGTAGAGTTGT No data
Right 913549997 1:119907847-119907869 GTTAGTTTTAAGGTCCTCAAGGG No data
913549991_913549998 29 Left 913549991 1:119907801-119907823 CCATTCTAGAGCAGTAGAGTTGT No data
Right 913549998 1:119907853-119907875 TTTAAGGTCCTCAAGGGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913549991 Original CRISPR ACAACTCTACTGCTCTAGAA TGG (reversed) Intergenic
No off target data available for this crispr