ID: 913549998

View in Genome Browser
Species Human (GRCh38)
Location 1:119907853-119907875
Sequence TTTAAGGTCCTCAAGGGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913549990_913549998 30 Left 913549990 1:119907800-119907822 CCCATTCTAGAGCAGTAGAGTTG No data
Right 913549998 1:119907853-119907875 TTTAAGGTCCTCAAGGGTCGAGG No data
913549991_913549998 29 Left 913549991 1:119907801-119907823 CCATTCTAGAGCAGTAGAGTTGT No data
Right 913549998 1:119907853-119907875 TTTAAGGTCCTCAAGGGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913549998 Original CRISPR TTTAAGGTCCTCAAGGGTCG AGG Intergenic
No off target data available for this crispr