ID: 913552395

View in Genome Browser
Species Human (GRCh38)
Location 1:119928363-119928385
Sequence CTTAGATACTTAAAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913552395_913552404 7 Left 913552395 1:119928363-119928385 CCTGCCCCCTTTAAGTATCTAAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 913552404 1:119928393-119928415 CTAAGCTTCTCTGAGTCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 184
913552395_913552406 11 Left 913552395 1:119928363-119928385 CCTGCCCCCTTTAAGTATCTAAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 913552406 1:119928397-119928419 GCTTCTCTGAGTCCTAGGGGTGG No data
913552395_913552405 8 Left 913552395 1:119928363-119928385 CCTGCCCCCTTTAAGTATCTAAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 913552405 1:119928394-119928416 TAAGCTTCTCTGAGTCCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 119
913552395_913552409 25 Left 913552395 1:119928363-119928385 CCTGCCCCCTTTAAGTATCTAAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 913552409 1:119928411-119928433 TAGGGGTGGAAAGATCATGGTGG No data
913552395_913552403 6 Left 913552395 1:119928363-119928385 CCTGCCCCCTTTAAGTATCTAAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 913552403 1:119928392-119928414 CCTAAGCTTCTCTGAGTCCTAGG 0: 1
1: 0
2: 2
3: 69
4: 1255
913552395_913552410 29 Left 913552395 1:119928363-119928385 CCTGCCCCCTTTAAGTATCTAAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 913552410 1:119928415-119928437 GGTGGAAAGATCATGGTGGCAGG No data
913552395_913552407 22 Left 913552395 1:119928363-119928385 CCTGCCCCCTTTAAGTATCTAAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 913552407 1:119928408-119928430 TCCTAGGGGTGGAAAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913552395 Original CRISPR CTTAGATACTTAAAGGGGGC AGG (reversed) Intronic
904779284 1:32933100-32933122 CTTAGACTCTTAACGGGGGAAGG - Intergenic
911313998 1:96333912-96333934 CTTAGATATTTTAAGGAGGATGG + Intergenic
913552395 1:119928363-119928385 CTTAGATACTTAAAGGGGGCAGG - Intronic
917283107 1:173397826-173397848 CTAAGATACTTCAAGGATGCAGG + Intergenic
918068901 1:181120697-181120719 TTGAAATACTTAAAGGAGGCCGG - Intergenic
924222015 1:241887290-241887312 CTTAAATAATTAACTGGGGCTGG - Intronic
1064018636 10:11791952-11791974 TTTCAATATTTAAAGGGGGCCGG + Intergenic
1066421044 10:35265099-35265121 CTTAATTTCTTAAAGGGGGAGGG + Intronic
1069693960 10:70373489-70373511 CTTATACACTCTAAGGGGGCTGG - Intronic
1070496756 10:77031458-77031480 CTTAGATACCTATAGGGTTCAGG - Intronic
1073029928 10:100517648-100517670 AGTAGATACTTAATGGGGGAGGG + Intronic
1073579412 10:104650702-104650724 CTTAAATACTTAAAAGTGCCTGG + Intronic
1074691026 10:116004218-116004240 CTTAGATACATAAACACGGCTGG - Intergenic
1077837400 11:5936939-5936961 CTTGTATAATTAAAGGGGGTAGG - Intronic
1082691386 11:56308578-56308600 CTTAGAAAAGTAATGGGGGCAGG - Intergenic
1085371218 11:76007283-76007305 CTAAGAAATGTAAAGGGGGCTGG - Intronic
1088726778 11:112645649-112645671 TTAAGATACTTAGAAGGGGCTGG + Intergenic
1088823276 11:113474579-113474601 CTTAGAAACTGAAAAGGGTCAGG + Intronic
1089435402 11:118460901-118460923 CTTAGATACTTCTTGGGAGCAGG + Intronic
1091391377 12:128370-128392 CTTAGTGACATAAAGGGGGATGG + Intronic
1091510802 12:1123696-1123718 TTTAAATACATAAAGCGGGCCGG + Intronic
1091987913 12:4928122-4928144 CTTAGAAATTTACAGGGGACAGG + Intronic
1097077542 12:56406751-56406773 GTAAGATATTTAAAAGGGGCCGG - Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1102013488 12:109633047-109633069 CATAAATGCTTAAAGGGTGCAGG + Intergenic
1104312759 12:127669162-127669184 CTCAGATACTTCAAGGCTGCAGG + Intergenic
1106282080 13:28283555-28283577 TTTATATATTTAAAGGGGGAGGG - Intronic
1107729876 13:43338271-43338293 CTGAGAAACTGAAAGTGGGCAGG + Intronic
1108079077 13:46714582-46714604 CTTAGATTCTTAAAGTAGGCTGG + Intronic
1108566378 13:51702484-51702506 ATAAGCTTCTTAAAGGGGGCTGG + Intronic
1110987272 13:81986308-81986330 CTTCAATATTTAAAGGGGGAAGG + Intergenic
1114192220 14:20448472-20448494 CTTAGATTCTAAATGGGGGGCGG - Intronic
1117501470 14:56356824-56356846 CTGGGCTCCTTAAAGGGGGCGGG + Intergenic
1127003717 15:54541456-54541478 CTTAGAGACTCAAAGAGGCCAGG + Intronic
1127166786 15:56251875-56251897 CATAGAAACTTAAGGGGAGCTGG + Intronic
1128287045 15:66445925-66445947 TTTAAATCCTTGAAGGGGGCTGG + Intronic
1133049538 16:3109348-3109370 ATTAAAAACTTAAACGGGGCTGG - Intergenic
1134422801 16:14110537-14110559 CTTTGAAGCTTAAAGGGGCCAGG - Intronic
1138650178 16:58455840-58455862 CTTAGATGCTTAAGGGAGGAGGG + Intergenic
1139728202 16:68919678-68919700 CATACATACTTAAAAGTGGCTGG - Intronic
1140483264 16:75274203-75274225 TTTAATTACTTAAAGGTGGCCGG - Intergenic
1140996741 16:80267545-80267567 CTTCGATATTTAAAGGGGCTGGG + Intergenic
1142910995 17:3090839-3090861 CTTAGCTACTCAGAGGGGTCTGG + Intergenic
1146965281 17:37022931-37022953 TTTAAATCCTTGAAGGGGGCTGG - Intronic
1148959077 17:51378058-51378080 CTGTGATACATAAAGGAGGCTGG - Intergenic
1149420407 17:56504967-56504989 CAAAGATACTTTAAGTGGGCTGG - Intronic
1149898616 17:60451773-60451795 ATTAAAGACTTAAATGGGGCTGG - Intronic
1151085926 17:71380494-71380516 CTTTTTTTCTTAAAGGGGGCAGG + Intergenic
1151134134 17:71929030-71929052 CATAGATGCTAAAAGGGGGATGG - Intergenic
1153246852 18:3080835-3080857 CTTAGAGAGTTAAACAGGGCCGG + Intronic
1155842975 18:30668887-30668909 CCTAGAGACTTAAAGGGCTCAGG - Intergenic
1158475593 18:57776652-57776674 CTTAGATCCTTAAAAGTGACTGG + Intronic
1159709892 18:71744650-71744672 CACAGAGACTTAAAGGCGGCAGG - Intronic
1162585649 19:11556694-11556716 CTTAGATAAATAAAGAGGGTGGG - Intronic
1163709695 19:18839387-18839409 GTTCTATACTTAAAGGGGCCAGG - Intronic
1166556828 19:43705664-43705686 CTTAAAAAATTAAAGGTGGCTGG - Intergenic
925353859 2:3223483-3223505 CTCACATACTCAGAGGGGGCGGG - Intronic
930458385 2:51636479-51636501 CTTATATACCTAAAGAAGGCAGG + Intergenic
936551104 2:113440178-113440200 CTTAGAAATATTAAGGGGGCCGG - Intronic
938605197 2:132884970-132884992 ATTAAATACCTAAAGGGTGCTGG + Intronic
939844837 2:147230435-147230457 CTTGGATACTTACACAGGGCTGG - Intergenic
940659650 2:156531218-156531240 CATATATATTTAAAGGGGGCAGG - Intronic
941733627 2:168947814-168947836 CTTAGAGACTTAAGGGCTGCAGG - Intronic
943432356 2:187819787-187819809 TTTACATAGTTACAGGGGGCTGG + Intergenic
943961916 2:194275315-194275337 CTTAAATACTTAAAGTGCTCAGG - Intergenic
944084759 2:195832736-195832758 CTTAAATACTTTAAGTAGGCTGG - Intronic
944704677 2:202276840-202276862 CTCAAAAACATAAAGGGGGCCGG + Intronic
945128432 2:206539419-206539441 CTCAGACAATTAAAGAGGGCTGG - Intronic
946059278 2:216927698-216927720 ATTAGAGACTGAGAGGGGGCAGG + Intergenic
948388073 2:237593945-237593967 CTCAGATACTTAAGAGGGTCTGG + Intronic
1170838684 20:19906495-19906517 CTTGGATGCTTACAGGGGCCAGG + Intronic
1181016667 22:20073619-20073641 CTTAGTTACTTAAAGTTGTCTGG + Intergenic
1182206940 22:28637306-28637328 ATTAAATACTTAAACGTGGCTGG - Intronic
957879503 3:86192796-86192818 CTTAGTAACTTGAAAGGGGCAGG + Intergenic
963728613 3:148948891-148948913 CTTAGAGACTTAGAGGGGAGTGG - Intergenic
964078689 3:152724190-152724212 CTTAGGGACTTAAAGGCTGCAGG + Intergenic
966805104 3:183801031-183801053 CTGAGATACTTAAAAGTAGCTGG - Intronic
966962993 3:184959264-184959286 CTTAGTTTCTTAAAGGAGTCTGG + Intronic
967083302 3:186070741-186070763 CTTAGATACTTCAAAAGGACTGG - Intronic
967134523 3:186502239-186502261 ATTACATACATAAAGGTGGCTGG + Intergenic
971599351 4:28572417-28572439 CTTAGATTCTTCCAGGGAGCAGG - Intergenic
974353959 4:60788176-60788198 CTTAAATACTTAAAGAGGCAGGG - Intergenic
984248112 4:177300038-177300060 CTTATATACTTGAAGAGAGCGGG + Intergenic
984913370 4:184697454-184697476 CTTAGCTACTTAATGAAGGCTGG - Intronic
985285020 4:188328632-188328654 CTTCAATATTTAAAGGGGGAAGG + Intergenic
985867734 5:2528567-2528589 CCTTGATGCTTAAAGGGGGTGGG - Intergenic
989194791 5:38706308-38706330 CTTTCATACCTAAAGGGGCCTGG - Intergenic
989535167 5:42555138-42555160 CATAGAAGCTTAAAGGAGGCAGG + Intronic
990670964 5:58129680-58129702 TTTAGAGACTTAGAGGGGGAAGG + Intergenic
992644118 5:78796545-78796567 CTTAGAGACTGAAAAGGGGAAGG - Intronic
996477994 5:123942611-123942633 TTAAGATACTAAAATGGGGCTGG - Intergenic
998959250 5:147467091-147467113 CTTAGATAGTTTAAAGGGCCAGG + Intronic
999138853 5:149343624-149343646 CTAAGAAACTAAAAGGGTGCTGG + Intergenic
1002057115 5:176604630-176604652 CTTAAATACTTCCAAGGGGCGGG - Intronic
1003704199 6:8506239-8506261 CTTAGAGTCTTAGAGGGGGATGG + Intergenic
1008866718 6:56220871-56220893 CTGAGATATTTAAAGGAAGCTGG + Intronic
1013921359 6:115408220-115408242 ATTAAATACTTAAATGTGGCCGG - Intergenic
1014659835 6:124156137-124156159 TTTAGACACTTAAGGGGGCCAGG + Intronic
1017402159 6:154077143-154077165 CTGAGAAACTGAAAGGGGGTGGG - Intronic
1017532222 6:155306709-155306731 CTGAGATAGATAAAGGGGGAAGG + Intronic
1018993621 6:168693394-168693416 CTAAGATCCTTAAAGGGATCTGG + Intergenic
1018993726 6:168694637-168694659 CTAAGATCCTTAAAGGGATCTGG - Intergenic
1019327143 7:444073-444095 TTTAGATACTGAAAGGGGAGGGG - Intergenic
1023282671 7:38587560-38587582 CTAAGATATTCACAGGGGGCTGG + Intronic
1025806124 7:64836215-64836237 CTTGTATAATTAAAGGGGGTAGG + Intergenic
1026117969 7:67512166-67512188 CCTTAATAGTTAAAGGGGGCTGG - Intergenic
1038823927 8:30979727-30979749 CTTAGAGACCTAAAGGATGCAGG - Intergenic
1039535958 8:38312894-38312916 CTTGAATGCTTAAAGGGGCCAGG + Intronic
1039955983 8:42207581-42207603 CCTGGAAACTTAAAGGAGGCCGG - Exonic
1042188726 8:66164295-66164317 CTTAGACACTTAAAGGTATCAGG - Intronic
1042757317 8:72229877-72229899 CTTAAATACTGGAAGGGGGCCGG - Intergenic
1043570337 8:81595622-81595644 CTTCAATATTTAAAGGGGGAAGG - Intergenic
1049915201 9:310987-311009 ATTAAAGACTTAAATGGGGCCGG + Intronic
1050207096 9:3208434-3208456 GCGAGATATTTAAAGGGGGCTGG + Intergenic
1050912160 9:11085132-11085154 CTTAGATACTTCAAGGTAACAGG + Intergenic
1052830015 9:33207406-33207428 CTGAGGTCCTTAAAGGGGGCAGG + Intergenic
1053513142 9:38706565-38706587 CTGAGATACTCCAAAGGGGCCGG - Intergenic
1057688448 9:97260095-97260117 TTTAGAAAGGTAAAGGGGGCTGG - Intergenic
1058580966 9:106456590-106456612 CTTCAATATTTAAAGGGGACAGG + Intergenic
1188009668 X:25042508-25042530 CTTAAAGACTTAAAATGGGCTGG - Intergenic
1190465899 X:50724775-50724797 TCTAGAAACTGAAAGGGGGCCGG - Intronic
1198022614 X:132674059-132674081 GTAAGATACTTAAAGGGGCAAGG - Intronic
1201770544 Y:17613647-17613669 CTTGTATAATTAAAGGGGGTAGG - Intergenic
1201831009 Y:18292339-18292361 CTTGTATAATTAAAGGGGGTAGG + Intergenic