ID: 913554423

View in Genome Browser
Species Human (GRCh38)
Location 1:119950723-119950745
Sequence CACTGTGTGCTGCCATACAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913554423_913554425 9 Left 913554423 1:119950723-119950745 CCTGTGTATGGCAGCACACAGTG 0: 1
1: 0
2: 1
3: 11
4: 141
Right 913554425 1:119950755-119950777 GCCACTTATGTCATCAAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 97
913554423_913554429 28 Left 913554423 1:119950723-119950745 CCTGTGTATGGCAGCACACAGTG 0: 1
1: 0
2: 1
3: 11
4: 141
Right 913554429 1:119950774-119950796 CAGGTTCCTTGGTTCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 164
913554423_913554427 17 Left 913554423 1:119950723-119950745 CCTGTGTATGGCAGCACACAGTG 0: 1
1: 0
2: 1
3: 11
4: 141
Right 913554427 1:119950763-119950785 TGTCATCAAAGCAGGTTCCTTGG 0: 1
1: 0
2: 0
3: 24
4: 181
913554423_913554428 23 Left 913554423 1:119950723-119950745 CCTGTGTATGGCAGCACACAGTG 0: 1
1: 0
2: 1
3: 11
4: 141
Right 913554428 1:119950769-119950791 CAAAGCAGGTTCCTTGGTTCAGG 0: 1
1: 0
2: 0
3: 19
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913554423 Original CRISPR CACTGTGTGCTGCCATACAC AGG (reversed) Exonic
900749218 1:4383787-4383809 CACTGTGTGCTGACTTTCCCTGG + Intergenic
901029037 1:6295681-6295703 CACTGTATGCTGCCATTGACAGG + Intronic
907430667 1:54409459-54409481 CACTGAGTGTTAACATACACAGG - Intronic
912764738 1:112398029-112398051 CAATGTGTGCTGCAATAGAAGGG + Intronic
913205738 1:116536965-116536987 CACTGTGTCCTGCCAAGCACAGG - Intronic
913554423 1:119950723-119950745 CACTGTGTGCTGCCATACACAGG - Exonic
917912798 1:179668617-179668639 CACTGAGTGCTACCATACACAGG - Intronic
918339076 1:183552425-183552447 CACTGAATTCTTCCATACACAGG + Intronic
919349586 1:196432298-196432320 GACTCTGTGCTGCCATACCCCGG - Intronic
919565696 1:199182716-199182738 ACCTGTGTGCTGCCACACATTGG - Intergenic
921193954 1:212734594-212734616 CATTCTGTGATTCCATACACAGG + Intronic
921552986 1:216561625-216561647 CAAAGTGTGCTGCCTTACCCTGG - Intronic
1063053042 10:2474465-2474487 CACTGGGTTGTGCCATACCCTGG - Intergenic
1063910665 10:10826577-10826599 CACTGGGTTCTGTCATAGACAGG - Intergenic
1065754572 10:28919389-28919411 CACTGTGCCCTGTCATGCACTGG - Intergenic
1073468566 10:103708760-103708782 CACTTTGTGCTGCCCAAGACAGG - Intronic
1074291635 10:112142042-112142064 CACTATGTGTGGCCACACACAGG + Intergenic
1076467406 10:130693445-130693467 GAGTGTGTGCTGCCGTACTCAGG - Intergenic
1077462908 11:2719734-2719756 CACTGTGTGGTGAGAAACACAGG - Intronic
1085422486 11:76375320-76375342 CACTGTGAGCTGCCTCACAGTGG + Intronic
1088577442 11:111285575-111285597 CATTGTGTGCTGCCAGACTGTGG - Intronic
1091064734 11:132499050-132499072 CAAGGTGTGCTACCATGCACGGG - Intronic
1095982481 12:47981227-47981249 CCCTGTGTGCTGCCAGGCACTGG - Intronic
1098158500 12:67624478-67624500 CACTGAGTGGTGCCATAGCCAGG - Intergenic
1099474895 12:83096245-83096267 CCCTACGTGCTGCCATTCACTGG - Intronic
1101406547 12:104433877-104433899 CACTGTGCCCGGCCATAAACAGG - Intergenic
1101650836 12:106675802-106675824 CACTGTGTTCTGTCTTACTCTGG - Intronic
1103771405 12:123329089-123329111 CACTGTGTCCTACCAAAAACTGG - Intronic
1105705969 13:22967585-22967607 CCCTGTGTGCTGAGATACAGGGG - Intergenic
1105858870 13:24392569-24392591 CCCTGTGTGCTGAGATACAGGGG - Intergenic
1106120447 13:26855621-26855643 CTCTGTGTGATGCCAAGCACTGG + Intergenic
1112433109 13:99370249-99370271 CACTATGTACTGACATGCACAGG - Intronic
1112794150 13:103036517-103036539 CATTGTGTGATACAATACACAGG + Intergenic
1113199855 13:107855151-107855173 CTCTGGGTGCTGCCTTAAACTGG + Intronic
1116967600 14:51030523-51030545 TACTGTGTGCTTCCATTCCCAGG - Intronic
1117665726 14:58053719-58053741 GACAGTGTGCTCCCAGACACAGG - Intronic
1117838468 14:59832157-59832179 CAATGTGTACTTCCTTACACTGG - Intronic
1118322202 14:64759761-64759783 CACTGAGGGCTGCCACCCACCGG + Intronic
1121512518 14:94522883-94522905 GACTGTGTGCTGCATTGCACTGG + Intergenic
1123113763 14:105884679-105884701 CACCGTGTGCTGCCAAACAGGGG - Intergenic
1124460715 15:29888801-29888823 CAGTGTGTGCGGCTACACACTGG - Intronic
1125606148 15:40941094-40941116 CACTGTGAGGTGCCTTCCACAGG + Intergenic
1125971275 15:43913648-43913670 CACTGTGTGTTGCCAGGCAAGGG + Intronic
1127630627 15:60824167-60824189 CACTATGGGCTGCCATAATCAGG + Intronic
1130133413 15:81161922-81161944 CACTTTATGTTGCCAAACACAGG + Intronic
1131619011 15:94047269-94047291 CAGTGTCTGCTGCCAATCACAGG - Intergenic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1133666775 16:7975891-7975913 CACAGTTTGCTTCCATACATTGG - Intergenic
1133813045 16:9176187-9176209 CAGTTTGTGCTGCCACAGACGGG + Intergenic
1134048212 16:11117161-11117183 CACTGTGTACTGCCAAAGGCAGG + Intronic
1136878476 16:33883758-33883780 CACTGTGTACTGCTAGACAGTGG + Intergenic
1138496976 16:57414899-57414921 GTCTGTGTGTTACCATACACAGG - Intronic
1139336934 16:66239222-66239244 CACTTTGTGCTGCCATGCTGGGG - Intergenic
1139420830 16:66848694-66848716 CAGAATGTGCTGCCATTCACGGG - Intronic
1139892137 16:70260058-70260080 CACTGTGCCCAGCCATAAACAGG + Intronic
1141077270 16:81018715-81018737 AGCTGTGTGCCGCCATACCCTGG + Intronic
1142203622 16:88772490-88772512 CACTGTGCCCTGCCAGGCACGGG - Intronic
1143260529 17:5595258-5595280 CACTGCGTTCTGCCACCCACTGG + Intronic
1143358311 17:6347469-6347491 CACTGTGCCCTTCCATACCCTGG + Intergenic
1144492964 17:15730904-15730926 CACTGTGTGATGCCATCCTCGGG + Intergenic
1144907288 17:18645749-18645771 CACTGTGTGATGCCATCCTCGGG - Intronic
1145068602 17:19783137-19783159 CACTGTATGTTTCAATACACTGG + Intronic
1149230265 17:54525597-54525619 CACTGGGTGCTGCCACAAAGTGG - Intergenic
1152272142 17:79330916-79330938 CGCTGTGTTCTGACACACACTGG + Intronic
1152400175 17:80061518-80061540 CCCTGTGTGCTTCCACACCCTGG + Intronic
1152903990 17:82960645-82960667 CACTGGGTGCTGCGATTCCCTGG + Intronic
1155114593 18:22751990-22752012 CACTGTGGGCTGCCACAGCCTGG + Intergenic
1158249573 18:55472151-55472173 CATTGTGTGCTGTCATAAACAGG + Intronic
1159939755 18:74397826-74397848 CTCACTGTGCTGCCAGACACTGG + Intergenic
1160403270 18:78627431-78627453 CACTGTTAGCTGCTAAACACTGG + Intergenic
1162137558 19:8565059-8565081 CACTGTGTCCGGCCAGAGACAGG + Intronic
1162947100 19:14050754-14050776 CTCTGTGTGTTGCCACTCACTGG - Exonic
1163390971 19:17029545-17029567 CACTGTGTGAGGCCACACAGGGG - Intergenic
1167853029 19:52216282-52216304 CACTGAGTCCTGTCATTCACAGG + Intronic
1168606027 19:57760441-57760463 GACTGTGTGCTCTAATACACGGG - Intergenic
928074727 2:28253733-28253755 CAGTGTCTGCAGCCATGCACAGG + Intronic
932513988 2:72326019-72326041 CACTCTCTGCTGCCCTCCACCGG + Intronic
933049658 2:77587899-77587921 CTGTGTGTGCTGCCATAGAAAGG - Intronic
934710169 2:96509229-96509251 CACCGCGTGCTGCCATTCATAGG + Intergenic
935069415 2:99680916-99680938 CACTGTGTTATGCCATCCTCAGG - Intronic
941081338 2:161064155-161064177 CACTCTTGGCTGCCATTCACAGG - Intergenic
941953036 2:171176285-171176307 CACAGTGTGCTGCTCAACACTGG - Intronic
945844350 2:214926501-214926523 CATTGTGGGCTTCCTTACACTGG + Intergenic
947881218 2:233514983-233515005 CATTGTGTGGTTCCATACATAGG - Intronic
1169058452 20:2642751-2642773 CACTCTGTGCTCCCAGACCCAGG + Intergenic
1170517778 20:17149489-17149511 CACTGTCTGCTGTCACTCACTGG + Intergenic
1173449552 20:43150743-43150765 CACTGTGTCCGGCCTTCCACAGG + Intronic
1175581397 20:60102515-60102537 CTATGTGTGCTGCCATGCAGGGG + Intergenic
1176703273 21:10084889-10084911 AACTGTGTGCCACCATACCCAGG + Intergenic
1176898963 21:14417072-14417094 CACTGTGTCCTGACATACCAGGG + Intergenic
1179116146 21:38494285-38494307 CACAGTGTGCTACCAAACGCTGG + Intronic
1181105366 22:20571425-20571447 CACCATGTGCTGCCATGCAGGGG + Intronic
1182078485 22:27511645-27511667 CTCTGTGTGCTACCGAACACAGG + Intergenic
949656849 3:6230770-6230792 CACTGTGAGATTCCAGACACAGG - Intergenic
949881216 3:8662410-8662432 CTCTGGGTCCTGCCATTCACTGG - Intronic
950675009 3:14549468-14549490 CACCGTGTTCAGCCACACACTGG - Intergenic
951018634 3:17757551-17757573 CTCTGTGTACTGGCAAACACTGG + Intronic
951867595 3:27325119-27325141 GGCTGAGTGCTGCCATGCACTGG + Intronic
952750939 3:36824391-36824413 CACTGTGCTGTGCCATCCACTGG + Intergenic
955214095 3:56970774-56970796 TCCTGAGTGCTGCCATACAGGGG + Intronic
961366791 3:126405203-126405225 TACTGTATGCTGCCACTCACAGG - Intronic
962150109 3:132883448-132883470 CACTGTGAGGTGCAATACAAGGG + Intergenic
965202545 3:165677839-165677861 CACTGTGTGCTCCTACACAGTGG + Intergenic
965299059 3:166987672-166987694 CACTCTGTGGAGCCATACATAGG - Intergenic
969084912 4:4649075-4649097 CAGTGTGTGCTGGAAGACACAGG - Intergenic
970096441 4:12468455-12468477 CACTGTGTGCTGTGATCCCCAGG - Intergenic
971491868 4:27221071-27221093 CACTGAATGCTGCAAAACACTGG - Intergenic
972264501 4:37446072-37446094 CACTGTGTGTTAACATCCACCGG + Exonic
972967828 4:44533817-44533839 AACTGTGTGCTGTCTTACAGAGG - Intergenic
973766215 4:54165396-54165418 CAGTGTGTGCTGCAATCCACAGG - Intronic
974471140 4:62319484-62319506 TACTGTGAGCTGCCCTACAGAGG + Intergenic
978656057 4:111067013-111067035 CAGTGTGAGCTGCCATAGTCAGG + Intergenic
979591207 4:122482492-122482514 CCCAGTGTGCTGCCACAGACAGG - Intergenic
985080631 4:186260823-186260845 CACTGTGTGCTCATATACAGGGG + Intergenic
986369709 5:7068127-7068149 TACTGTCTGCTACCATCCACTGG + Intergenic
990599421 5:57342527-57342549 AACTGTGTGCTTCAACACACAGG - Intergenic
992857495 5:80877748-80877770 CACTGTGTGCTGCCACTGCCAGG - Intergenic
993109932 5:83644442-83644464 CACTGTGTTCTGCCCCCCACAGG + Exonic
994945731 5:106386694-106386716 CACTCTGTTCTGCCATATATTGG - Intergenic
996683371 5:126252841-126252863 AACTGTGTGATGCCATAGAAGGG + Intergenic
1001677531 5:173531035-173531057 CACAGGGGGCTGCCTTACACAGG + Intergenic
1008691864 6:53987917-53987939 CTTTGTTTGCTGCCATTCACAGG + Intronic
1008943593 6:57073241-57073263 CATTGTGAGCTGGCATAAACCGG - Intergenic
1014257397 6:119175437-119175459 TCCTCTGTGCTGCCAGACACAGG - Intergenic
1016414263 6:143816646-143816668 CACTGTGTACTGCGATCCATGGG + Intronic
1019995408 7:4721250-4721272 CCCTGTGCACTGCCACACACAGG - Intronic
1022029610 7:26480199-26480221 TGCTGTGTGCTGCCAGAAACGGG - Intergenic
1024309274 7:47954207-47954229 CACTGTGTGCTGCCGTGAACTGG + Intronic
1029302601 7:99596086-99596108 CACAGTGTGCTAACAAACACTGG + Intronic
1031260602 7:119514536-119514558 CCCTGTGTGCTCCCAAACACTGG - Intergenic
1033280764 7:140004880-140004902 CACTGTGTGCTGCCAGCCTAGGG + Intronic
1035789057 8:2287099-2287121 CACTGTGCCCAGCCAGACACAGG + Intergenic
1035803748 8:2434606-2434628 CACTGTGCCCAGCCAGACACAGG - Intergenic
1040531536 8:48270332-48270354 CACTGTGTGTGGCCACCCACTGG - Intergenic
1045378959 8:101603882-101603904 CTCTTTCTGCTGCCACACACTGG - Intronic
1045496718 8:102715532-102715554 CACTGTGTGCAGCCAGGAACTGG - Intergenic
1049778768 8:144418068-144418090 GACTCTGTCCCGCCATACACAGG + Intergenic
1050096492 9:2072889-2072911 CACTGTGGTCTGCCCTGCACCGG + Intronic
1053640537 9:40071923-40071945 AACTGTGTGCCACCATACCCAGG + Intergenic
1053765601 9:41393550-41393572 AACTGTGTGCCACCATACCCAGG - Intergenic
1054321228 9:63667921-63667943 AACTGTGTGCCACCATACCCAGG + Intergenic
1054544213 9:66304704-66304726 AACTGTGTGCCACCATACCCAGG - Intergenic
1055382128 9:75719229-75719251 CAGTTTGTGCTGCTATAGACTGG + Intergenic
1056994766 9:91445580-91445602 CAATGTGTGTAGCCATACTCTGG - Intergenic
1059246040 9:112850513-112850535 CACTGTGTGCAGCCAGAGCCCGG - Intronic
1061801661 9:133116276-133116298 CTCTGTGGGCTGCCATGCCCAGG - Intronic
1062427597 9:136513020-136513042 AACTGCCTGCTGCCCTACACAGG - Exonic
1202788305 9_KI270719v1_random:54996-55018 AACTGTGTGCCACCATACCCAGG + Intergenic
1187109812 X:16285418-16285440 CTGTGTGAGCTGCTATACACTGG - Intergenic
1194519480 X:94901299-94901321 CAATGTGTGGTGCCAGCCACAGG + Intergenic
1197231811 X:124013643-124013665 CACTGGCTGCTGCTAGACACTGG - Intronic
1197277103 X:124492572-124492594 TAATGTGTGCTGACATAAACTGG + Intronic
1200009120 X:153108195-153108217 CGCTGTGGGCTGGCAGACACTGG + Intergenic
1200030480 X:153291727-153291749 CGCTGTGGGCTGGCAGACACTGG - Intergenic