ID: 913554802

View in Genome Browser
Species Human (GRCh38)
Location 1:119954752-119954774
Sequence ATACTCATTGTATGAATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913554802_913554810 18 Left 913554802 1:119954752-119954774 CCAAAGATTCATACAATGAGTAT 0: 1
1: 0
2: 2
3: 16
4: 189
Right 913554810 1:119954793-119954815 CCTTGCTAATGACCCATATAAGG 0: 1
1: 0
2: 0
3: 3
4: 69
913554802_913554805 -6 Left 913554802 1:119954752-119954774 CCAAAGATTCATACAATGAGTAT 0: 1
1: 0
2: 2
3: 16
4: 189
Right 913554805 1:119954769-119954791 GAGTATGGGTTCCTCCCATGAGG No data
913554802_913554811 19 Left 913554802 1:119954752-119954774 CCAAAGATTCATACAATGAGTAT 0: 1
1: 0
2: 2
3: 16
4: 189
Right 913554811 1:119954794-119954816 CTTGCTAATGACCCATATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913554802 Original CRISPR ATACTCATTGTATGAATCTT TGG (reversed) Intronic
900493549 1:2965496-2965518 ATAGTCATTGAATGAATGTGTGG - Intergenic
900721776 1:4180868-4180890 ATTCTCATTGTATGTATTTAAGG + Intergenic
901721292 1:11200178-11200200 ATAATCATTAAATGATTCTTGGG + Intronic
902111143 1:14079452-14079474 AGACTCATCAAATGAATCTTTGG + Intergenic
902997387 1:20237311-20237333 ATACTCTTTGCATAAATATTTGG - Intergenic
904101500 1:28032919-28032941 TTACTAATTGTATGAACTTTGGG + Intronic
906528480 1:46510147-46510169 ATACTCATAGTATCCATCTTAGG + Intronic
907919916 1:58902873-58902895 CTGCTCATTGTAGGAATATTGGG + Intergenic
912124091 1:106511308-106511330 AAACTGATTGTATGAATTTGGGG - Intergenic
913554802 1:119954752-119954774 ATACTCATTGTATGAATCTTTGG - Intronic
916647954 1:166806535-166806557 GTACTCAGTATATGAATCATGGG - Intergenic
917555070 1:176076902-176076924 TTTCTTATTGTTTGAATCTTGGG - Intronic
918129887 1:181618037-181618059 AGACTCATTGTCTACATCTTTGG - Intronic
918900114 1:190405083-190405105 ATCCACATTTTCTGAATCTTAGG + Intronic
919481341 1:198093656-198093678 TTACTCATTGTCTTAGTCTTTGG + Intergenic
919642398 1:200058449-200058471 ATAATAAATGTATGTATCTTCGG - Intronic
921281240 1:213570242-213570264 ATACTCATAGTATTTATCTCAGG + Intergenic
922588895 1:226757902-226757924 ATACACATTGTGTGTATGTTTGG + Intergenic
922655396 1:227377990-227378012 AAACTCAAAATATGAATCTTGGG - Intergenic
924115113 1:240737677-240737699 ATACTCATTGAATAATTCTGTGG + Intergenic
1065527393 10:26637256-26637278 GTACTCAGTGTAGGAATTTTAGG + Intergenic
1066166868 10:32798105-32798127 AGAATCATTGTATGCATCATAGG + Intronic
1068307921 10:55238744-55238766 ATAATCATTGTATGTATCTATGG + Intronic
1073031312 10:100528312-100528334 CTCCTCATTGTATGAACATTAGG - Intronic
1075007076 10:118838998-118839020 AGTCTCAATGTATGAATCTGAGG + Intergenic
1078489150 11:11753296-11753318 AAAATCACTGTATGAATATTGGG - Intergenic
1080216865 11:29853331-29853353 ATTGTCATTCTATGAATTTTGGG - Intergenic
1080832120 11:35904411-35904433 TTAGTCAATGTAGGAATCTTAGG + Intergenic
1081178760 11:39961576-39961598 ATAATCTTTGTAAGAATATTGGG + Intergenic
1081268125 11:41052149-41052171 GTAATCATTGTATGAATCATAGG - Intronic
1086661263 11:89421363-89421385 ATACTCTTTGTAATAAGCTTAGG + Intronic
1088052745 11:105538078-105538100 ATTCAGATTGTATGAATCATTGG + Intergenic
1090326999 11:125896802-125896824 ATATTCATTAGATGAATATTAGG + Intronic
1092514027 12:9188949-9188971 ATTCTCATTGTAGAGATCTTTGG - Intronic
1092514245 12:9192046-9192068 ATACTCGTCTTATGACTCTTTGG - Intronic
1094582883 12:31750615-31750637 ATACTCATTGTCTTAATGATTGG - Intergenic
1095869086 12:47005913-47005935 ATTACCATTTTATGAATCTTGGG - Intergenic
1095895390 12:47275198-47275220 ATACTCATTGTATCAGTGATTGG + Intergenic
1096840680 12:54377985-54378007 ATTCTCATGGTATGGATGTTGGG - Intronic
1096881058 12:54671251-54671273 AAAATCTTTGTCTGAATCTTTGG + Intergenic
1098435008 12:70459547-70459569 ATACTCATTGTCTCAGTCATTGG - Intergenic
1098435474 12:70464110-70464132 ATACTCATTGTCTCAGTCATCGG - Intergenic
1098603928 12:72366934-72366956 ATATTCATTATATGTATCTGTGG + Intronic
1098608543 12:72424821-72424843 ATACTTATTAAATGAATATTGGG - Intronic
1099874564 12:88389164-88389186 ATACTCATTGTCTCAGTCATTGG - Intergenic
1101293453 12:103395639-103395661 ATACACATTGTAAGAATAATGGG - Intronic
1102663314 12:114548347-114548369 ATAGTCACTGCATGAATCTGTGG - Intergenic
1104361809 12:128140148-128140170 ATAATCATTGTTTGTGTCTTAGG + Intergenic
1104438315 12:128774624-128774646 ATACTAATTGTATGTATTTATGG + Intergenic
1104740234 12:131166527-131166549 ATATTCACTGAATGGATCTTTGG + Intergenic
1106909931 13:34452744-34452766 ATTATCATTGTTTGAAACTTGGG - Intergenic
1107238987 13:38209841-38209863 ATACTCAGTTTGTGAAGCTTGGG - Intergenic
1109451143 13:62515906-62515928 ATGCTAATTGTATGATACTTGGG + Intergenic
1109688578 13:65854417-65854439 ATTGTCATTGTAGAAATCTTGGG + Intergenic
1111431414 13:88151839-88151861 ATCCTCATTGGCTGAAGCTTGGG - Intergenic
1113607327 13:111619149-111619171 AGACTCATCAAATGAATCTTCGG - Intronic
1115573041 14:34684934-34684956 ATATTCATTGTAAAAATATTTGG + Intergenic
1120279159 14:82417317-82417339 TTATTCTTTGTATGAATTTTGGG + Intergenic
1120673588 14:87392715-87392737 ATACTTATTGTAAAAATATTAGG - Intergenic
1122334053 14:100955394-100955416 GTATTCATTGTATGACTCATAGG - Intergenic
1125821291 15:42634056-42634078 ATACTCTTCCTTTGAATCTTTGG - Intronic
1126303707 15:47229847-47229869 ATTTTCATTGAATGAATGTTTGG + Intronic
1126378794 15:48024443-48024465 AGACTCATCAAATGAATCTTTGG - Intergenic
1126559393 15:50026817-50026839 CTACTCATTGTAAGACTCTTGGG - Intronic
1128011310 15:64299117-64299139 AGACTCATTGTAAGAAACTTTGG - Intronic
1129613041 15:77075495-77075517 ATCCCCATTGTATGAATTTTGGG + Intronic
1130241243 15:82194274-82194296 ATATTTATGGAATGAATCTTAGG - Intronic
1130459182 15:84146885-84146907 ATATTTATGGAATGAATCTTAGG + Intergenic
1130740197 15:86591158-86591180 AGATTCATTTTATGCATCTTTGG + Intronic
1131189530 15:90302624-90302646 ATTCTCATTGTATAAAATTTGGG + Intronic
1132770748 16:1561572-1561594 ATATTCACTGTAGGGATCTTAGG - Intronic
1133391627 16:5414883-5414905 ATATTTATTGGATGAAGCTTAGG - Intergenic
1133465615 16:6024457-6024479 ATACTCATTGGATAAATGTATGG - Intronic
1134192692 16:12134798-12134820 ATACTACTTGTATTAATGTTAGG + Intronic
1136749652 16:32622644-32622666 ATAAGCTTTGTATGAATCTGTGG + Intergenic
1136839445 16:33526311-33526333 CTACTCACCGTATGACTCTTGGG - Intergenic
1139200754 16:64974328-64974350 ATACTCATTTTGTAAATTTTGGG - Intronic
1203051786 16_KI270728v1_random:881848-881870 ATAAGCTTTGTATGAATCTGTGG + Intergenic
1203149609 16_KI270728v1_random:1826596-1826618 CTACTCACCGTATGACTCTTGGG - Intergenic
1145361810 17:22218135-22218157 ATGCTCAGTGTATGAAATTTAGG + Intergenic
1146303907 17:31715137-31715159 ATTCTCAGTGTATCAATATTGGG + Intergenic
1150114043 17:62529050-62529072 AAACTCAGTGTTTAAATCTTAGG + Intronic
1155127925 18:22898507-22898529 ATAAACATTGTATGTATTTTTGG + Intronic
1156356060 18:36341079-36341101 CTACTAATTGTGTCAATCTTAGG + Intronic
1158301819 18:56061064-56061086 ATACTCATTGTGTCAGTCATTGG + Intergenic
1159064023 18:63549646-63549668 ATAAAGATTGTAGGAATCTTTGG + Intergenic
925521364 2:4749400-4749422 TTTCTCATTGGATGAATCTGGGG + Intergenic
926618011 2:15018396-15018418 ATAATAATTGTATGTATTTTTGG - Intergenic
927009938 2:18892829-18892851 ATAGTTACTGTGTGAATCTTTGG - Intergenic
928421346 2:31139399-31139421 ACACTCACTGTGTGAGTCTTGGG + Intronic
930360528 2:50372575-50372597 GTACTCATTTTATAAATCTGAGG - Intronic
930756097 2:54974594-54974616 ATTCTCATTGTATGAAAAGTAGG - Intronic
931896229 2:66733143-66733165 ATAGTAATTGTATGTATTTTGGG - Intergenic
933306878 2:80611684-80611706 ATACGCTCTGTATAAATCTTTGG - Intronic
933537240 2:83591370-83591392 CTACTCATTTTCTGTATCTTTGG - Intergenic
934184393 2:89658716-89658738 ATACTGATTGGATCAATCTGCGG + Intergenic
934294678 2:91732854-91732876 ATACTGATTGGATCAATCTGCGG + Intergenic
935960482 2:108420891-108420913 ATACTCATTGTTGTAATGTTTGG + Intergenic
939436959 2:142189578-142189600 TTACTCATTGTATGCATCTTTGG - Intergenic
940388181 2:153098797-153098819 ACACACATTCTATGACTCTTTGG - Intergenic
940509056 2:154589368-154589390 ATGCTCAGTACATGAATCTTAGG + Intergenic
942285426 2:174411259-174411281 ATACCCACTATATGAATATTTGG + Intronic
942531965 2:176920519-176920541 ATACTCATTGTCTCAATGATTGG + Intergenic
944519445 2:200549328-200549350 ATAATCATTGTTTAAATTTTTGG - Intronic
944576580 2:201096583-201096605 ATATTCATTATAAGAATTTTTGG - Intergenic
945477068 2:210296168-210296190 ATACTAATTGTATGTATTTACGG + Intronic
945827063 2:214734543-214734565 TTGCTCATTGGATGAATATTAGG - Intronic
1170140326 20:13119567-13119589 ATGCTCATTTTATGCATATTTGG + Intronic
1172442312 20:34974549-34974571 CTACTCAGTGTATGAACCTGGGG - Intergenic
1173441696 20:43083103-43083125 ATACTCATTGTATCACTGGTGGG + Intronic
1175740107 20:61414177-61414199 AGACTCAGCATATGAATCTTGGG + Intronic
1177275704 21:18910481-18910503 ATACTCAATCCATGTATCTTGGG - Intergenic
1178004977 21:28208238-28208260 TTACTCATTTTAGGAATGTTTGG - Intergenic
1178791430 21:35703763-35703785 ATAATCATAGTTTGAATCATAGG - Intronic
1179283607 21:39956070-39956092 ATTCTCATTATATGAATTTAAGG + Intergenic
1179314688 21:40232346-40232368 ATAATAAATGTATGAATCTACGG + Intronic
1184875403 22:47271355-47271377 AAACTCATTGTAAGCATCTTCGG - Intergenic
950935567 3:16835547-16835569 ATACTCATTTTGTCAGTCTTTGG + Intronic
951185147 3:19704128-19704150 AAATTAATTGTATGATTCTTTGG + Intergenic
951371926 3:21859874-21859896 ATACATAATGCATGAATCTTCGG - Intronic
952942918 3:38456851-38456873 AACTTCATTGTATGAATTTTGGG + Intronic
956058654 3:65327633-65327655 ATGCTCATTGTCTGAAAGTTGGG - Intergenic
957799082 3:85051379-85051401 ATATTAAATGCATGAATCTTAGG + Intronic
958266037 3:91438201-91438223 ATACTTATTCTATGGATTTTTGG - Intergenic
959976870 3:112470921-112470943 ATTCTCTTTGCATCAATCTTAGG - Intronic
960440715 3:117684226-117684248 ACCCACATTGTATGAATGTTAGG + Intergenic
960919354 3:122730955-122730977 ATGCTCAGTGTATTAATATTTGG + Intergenic
960949770 3:122991827-122991849 ATACTCATGGTATGAGACTTAGG + Intronic
962583824 3:136821128-136821150 ATGCTCATTATAAGAATTTTAGG + Intronic
963856514 3:150259209-150259231 ATATTCATTGTAGAAAACTTAGG - Intergenic
963874085 3:150454036-150454058 ATACTCACTATATGAATTCTGGG - Intronic
964042660 3:152281344-152281366 ATACTCATTGCATGTAGATTTGG + Intronic
972185399 4:36522070-36522092 AAGCTCATTGTATCATTCTTAGG - Intergenic
975364237 4:73509937-73509959 ATTTTCAATGTATGAATTTTAGG + Intergenic
975516139 4:75250472-75250494 ATGCTTATTGTATGGATGTTTGG + Intergenic
975760733 4:77617433-77617455 ATAGTCATTGAATGAGTCATCGG + Intergenic
976443958 4:85109189-85109211 AGACTCATTAAATGAATCTGTGG - Intergenic
976547619 4:86355635-86355657 ATATTCATTCAATGAATATTTGG + Intronic
976612261 4:87042163-87042185 TTACTCATGGTATGAATAGTGGG + Intronic
978124321 4:105117895-105117917 ATATTCCTTGAATAAATCTTTGG + Intergenic
978429451 4:108618549-108618571 ATAATAAATGTATGAAACTTTGG - Intergenic
978561069 4:110034064-110034086 ATAACCATTGTAGCAATCTTGGG + Intergenic
985090371 4:186356723-186356745 ATAATCTTTGTTTAAATCTTAGG - Intergenic
985160127 4:187035409-187035431 AAACTCATTGCATGAGTTTTAGG + Intergenic
986584006 5:9295454-9295476 ACACTGAATGTTTGAATCTTAGG + Intronic
988361089 5:30237419-30237441 TTACTCATTGTATTAATCAGGGG - Intergenic
988369740 5:30351729-30351751 TTATACATTGTCTGAATCTTAGG + Intergenic
992037377 5:72793633-72793655 ATACTCTTTGTAAGAATCTAAGG + Intergenic
992548671 5:77841051-77841073 ATCCTCCTTGTCTGAACCTTTGG - Intronic
992669213 5:79042104-79042126 TTATTCATTGTATGAATCCTTGG + Intronic
993635271 5:90335345-90335367 ATACCCATTGTCTGAATATTTGG + Intergenic
993644716 5:90448016-90448038 ATACTTACTATTTGAATCTTGGG + Intergenic
1000722681 5:164727958-164727980 ATACTCATTGTCTCAGTCATTGG - Intergenic
1007989057 6:46236039-46236061 ATAATCATAGCATGCATCTTGGG - Intronic
1010034992 6:71314646-71314668 ATAATTATTCTAGGAATCTTGGG + Intergenic
1012561662 6:100588426-100588448 ATCCTACTTTTATGAATCTTTGG + Intronic
1014065444 6:117119235-117119257 ATCCTCATTGTAAGGATCGTAGG + Intergenic
1014705879 6:124746692-124746714 ATGCTCATTGTAGAAAACTTGGG - Intronic
1015363748 6:132373566-132373588 ACAGTCATTTTATGAATCCTGGG + Intronic
1015674352 6:135727513-135727535 ATACTCATTGTAGAAAATTTGGG - Intergenic
1016252626 6:142063975-142063997 ATATTCATTTTATAAATTTTGGG + Intronic
1023617348 7:42033451-42033473 ATACTCATTGGATTCTTCTTCGG - Intronic
1024100095 7:46023179-46023201 ATATTTATTTTATGAATATTTGG + Intergenic
1024337898 7:48228069-48228091 AAACTCATTGTATGAATAATGGG + Intronic
1024792578 7:52983810-52983832 ATACACATAATATGAATATTAGG + Intergenic
1026128601 7:67601576-67601598 ATACTCATTGTATGACTTTTTGG + Intergenic
1027953557 7:84851167-84851189 AAACTCATTGCATGTATATTTGG - Intergenic
1028683907 7:93571155-93571177 ACACTCATTATATGAAGCTCTGG + Intronic
1030152190 7:106418934-106418956 TTTCTCATAGAATGAATCTTTGG - Intergenic
1031475933 7:122221775-122221797 ATACTCAGTCCATGAATATTGGG - Intergenic
1032043748 7:128584823-128584845 AAACTCAGTGTTTAAATCTTAGG + Intergenic
1032537944 7:132680135-132680157 AGACACATTGTATGGTTCTTTGG + Intronic
1032538090 7:132681192-132681214 AGACACATTGTATGGTTCTTTGG - Intronic
1032566067 7:132946004-132946026 ATAATTATTGAATGTATCTTTGG - Intronic
1034643253 7:152621631-152621653 ATACTCCTTGACTGAGTCTTGGG - Intergenic
1034645713 7:152644907-152644929 GGACTCATCGAATGAATCTTCGG - Intronic
1035425550 7:158769852-158769874 ATGCTCATTTTATAAAGCTTGGG + Intronic
1035655103 8:1299448-1299470 ATACTCTTTGTGATAATCTTAGG + Intergenic
1035787480 8:2273076-2273098 AGACTCATGGTATGAAATTTGGG - Intergenic
1035805327 8:2448640-2448662 AGACTCATGGTATGAAATTTGGG + Intergenic
1037192147 8:16139485-16139507 ATCTTAATAGTATGAATCTTGGG + Intronic
1039219870 8:35318398-35318420 ATCCTCATTGTATGTGTCTTAGG - Intronic
1040100453 8:43496687-43496709 ATATTTATTGCATGAATTTTAGG + Intergenic
1041534701 8:58913075-58913097 ATATCCATTGAATGAATGTTTGG + Intronic
1043340637 8:79233828-79233850 TAACTCATTCTATGAAGCTTTGG + Intergenic
1044201459 8:89443272-89443294 AGATTCATTAAATGAATCTTTGG - Intergenic
1045318093 8:101060441-101060463 TTACTCATTCTATGGGTCTTTGG - Intergenic
1045339109 8:101235870-101235892 ATTCTCATTCTATGAATATCTGG - Intergenic
1045443050 8:102234084-102234106 ATACTCAAAGTATGAAAGTTGGG + Intronic
1048709230 8:137189259-137189281 TTACTCATTGAATGACTCTCAGG - Intergenic
1050803400 9:9643798-9643820 AAACTCATGGTATGAGTTTTGGG - Intronic
1051244779 9:15098783-15098805 TTTCTTATTCTATGAATCTTGGG - Intergenic
1051405987 9:16738216-16738238 ATCCTCATTCTATGAAACTCAGG - Intronic
1055592455 9:77831623-77831645 ATACTCTGTGTATTAATATTTGG + Intronic
1056374411 9:85992573-85992595 AGATTCATATTATGAATCTTTGG - Intronic
1056860904 9:90180782-90180804 ATACTCATTGTCTCAGTCATTGG + Intergenic
1057066490 9:92056993-92057015 ATATTCAATGTAGGATTCTTGGG + Intronic
1058614236 9:106808853-106808875 ATACTCATTTTATAAAATTTCGG + Intergenic
1062007730 9:134249740-134249762 ATACTCACTGTATGAGTGTTAGG - Intergenic
1203452378 Un_GL000219v1:131534-131556 ATACAAATTGTATAAATCTAAGG - Intergenic
1188702801 X:33285749-33285771 ATTCTCATTTTATGAGTCTCAGG - Intronic
1188702837 X:33286376-33286398 GTACTCATTGTATAAGTCTCTGG - Intronic
1189064181 X:37788760-37788782 ATTCTCATTCTCTGATTCTTTGG + Intronic
1193890791 X:87044182-87044204 ATAAAAATTGTATGAATCTTTGG - Intergenic
1194437889 X:93892088-93892110 GTATTCATTGTATGATTTTTGGG + Intergenic
1194981281 X:100443489-100443511 ATACTCACTGTATGAAATTTGGG + Intergenic
1195294811 X:103465359-103465381 ATACTAATTAAATGAATTTTTGG - Intergenic
1198031096 X:132754295-132754317 ATGCTGATTGTATGTGTCTTTGG - Intronic