ID: 913554806

View in Genome Browser
Species Human (GRCh38)
Location 1:119954780-119954802
Sequence ATTAGCAAGGACCTCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913554806_913554810 -10 Left 913554806 1:119954780-119954802 CCTCCCATGAGGTCCTTGCTAAT 0: 1
1: 0
2: 2
3: 8
4: 110
Right 913554810 1:119954793-119954815 CCTTGCTAATGACCCATATAAGG 0: 1
1: 0
2: 0
3: 3
4: 69
913554806_913554814 19 Left 913554806 1:119954780-119954802 CCTCCCATGAGGTCCTTGCTAAT 0: 1
1: 0
2: 2
3: 8
4: 110
Right 913554814 1:119954822-119954844 TTCCTCCTTATGTTCCATCTAGG 0: 1
1: 0
2: 1
3: 21
4: 255
913554806_913554811 -9 Left 913554806 1:119954780-119954802 CCTCCCATGAGGTCCTTGCTAAT 0: 1
1: 0
2: 2
3: 8
4: 110
Right 913554811 1:119954794-119954816 CTTGCTAATGACCCATATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913554806 Original CRISPR ATTAGCAAGGACCTCATGGG AGG (reversed) Intronic
901917484 1:12511154-12511176 ATTAGAAAGGAGCCCAAGGGGGG - Exonic
906383119 1:45345324-45345346 GCTCGCCAGGACCTCATGGGGGG - Exonic
909148925 1:71975416-71975438 ATTAGGAAGGACATGATAGGAGG + Intronic
909944305 1:81646391-81646413 ACTAGGAATGACTTCATGGGTGG + Intronic
913554806 1:119954780-119954802 ATTAGCAAGGACCTCATGGGAGG - Intronic
916931981 1:169587862-169587884 ATTAACAGAGACCTCATGTGAGG - Intergenic
920563307 1:206954724-206954746 GTCAGCAAGGACCTCAGGGCTGG + Intergenic
1065329108 10:24575034-24575056 ATAAGAAAGGACATCAGGGGTGG + Intergenic
1069655074 10:70081636-70081658 CTTGGCAAGGACGGCATGGGAGG + Intronic
1070572904 10:77654642-77654664 ATGAGCAAAGACATCAAGGGAGG + Intergenic
1073463443 10:103679705-103679727 ATTTGCAAGGTCCCCCTGGGGGG + Intronic
1075248309 10:120844604-120844626 ATTAGCAATCTTCTCATGGGAGG + Intergenic
1080539439 11:33252606-33252628 AAAAGCCAGGACCTCCTGGGAGG + Intergenic
1081420366 11:42868778-42868800 ATTAGGGAGGACCTCATGGAAGG - Intergenic
1085252839 11:75154888-75154910 ATTAGCTGGGACCACATGGAGGG + Intronic
1086209206 11:84297857-84297879 ATACGCAAGGACCTCAGGGTTGG - Intronic
1086370252 11:86149194-86149216 AGTAGCTAGGACCACAGGGGTGG + Intergenic
1086603589 11:88666070-88666092 ATTAGCAAAGAATTCAAGGGAGG - Intronic
1088739216 11:112753084-112753106 ATTAGCAGGGCTCTCAGGGGTGG + Intergenic
1088972978 11:114789799-114789821 AATAGCAAGGATGTCATGTGAGG - Intergenic
1096936452 12:55285165-55285187 ATAAGCAATGATCTCTTGGGGGG - Intergenic
1098030857 12:66252260-66252282 ATCTGGAAGGACCTGATGGGAGG - Exonic
1100551741 12:95652447-95652469 AATAGCATGCACCTCAGGGGTGG + Intergenic
1105700743 13:22934551-22934573 ATTACCGAGGTCCTCGTGGGCGG - Intergenic
1105853571 13:24357624-24357646 ATTACCGAGGTCCTCGTGGGCGG - Intergenic
1107456377 13:40559617-40559639 ATTCGGAATGACCTCATGGATGG - Exonic
1120461670 14:84805251-84805273 ACTATCAAAGACCTCATGAGAGG - Intergenic
1130890076 15:88126232-88126254 ATTTTCAAGGGCGTCATGGGGGG - Intronic
1133510089 16:6449790-6449812 ATTAGCAAGAACCTGATGGGAGG - Intronic
1134449816 16:14356258-14356280 AATAGGACTGACCTCATGGGTGG - Intergenic
1135027190 16:19007441-19007463 ATGAGCAAGAACCTGGTGGGCGG - Intronic
1135715225 16:24758951-24758973 ATTACCAAGTAGCTCCTGGGAGG - Intronic
1140594565 16:76393629-76393651 ATCAGCAAGGACTTCATGGGGGG + Intronic
1141478739 16:84292227-84292249 ATGAGCAAGAACCACATGGGAGG + Intergenic
1142132594 16:88437779-88437801 ATGAACAAGCACCTCAGGGGGGG + Exonic
1143013527 17:3879464-3879486 GTCAGCAAAGACCTCAGGGGAGG + Intronic
1153996219 18:10444234-10444256 ATTGGAAAGGACCTCAGGAGTGG + Intergenic
1154080471 18:11251313-11251335 CTTAGCAAGGGACTCATCGGTGG - Intergenic
1162299362 19:9835495-9835517 AAGAGCCAGGACCCCATGGGAGG - Intronic
926177544 2:10609289-10609311 ATTTGAAAGGACTTCATGGCCGG + Intronic
927104185 2:19809961-19809983 CTTAGAAATGCCCTCATGGGTGG + Intergenic
927429947 2:23018994-23019016 ATCAGCAGGTACCTCATGGCTGG - Intergenic
930660454 2:54047664-54047686 ATAAGCAAGGAACTAATGGGGGG - Intronic
931196567 2:60057619-60057641 ATGAGCAAGGACCTGAAAGGGGG + Intergenic
935446231 2:103159363-103159385 ATTAGCAAGGAACATATGTGGGG - Intergenic
936559761 2:113527022-113527044 ATCAGGAAGGACCCGATGGGTGG + Intergenic
936750738 2:115638682-115638704 AATAGCAAGGATTTCAAGGGAGG - Intronic
942317181 2:174707138-174707160 ATTAGGAACGATATCATGGGGGG + Intergenic
1168960366 20:1864946-1864968 TTTAGCATGGTCCACATGGGAGG + Intergenic
1174609996 20:51790981-51791003 AATCCCAAGGACCTCACGGGTGG - Exonic
1175550680 20:59815171-59815193 ATGAGGAGGGACCTCATCGGGGG + Intronic
1180834542 22:18923300-18923322 ATGTGCAAGGACTTCATGGGCGG - Intronic
1181032494 22:20155172-20155194 ATTGGCAAGGACCACAGGGAGGG - Intergenic
1181065346 22:20303211-20303233 ATGTGCAAGAACTTCATGGGCGG + Intergenic
1182433490 22:30315077-30315099 CTCAGCGAGGAACTCATGGGGGG + Intronic
1183439372 22:37814784-37814806 ATTAGCAAGCACCTTCTGTGTGG + Intronic
1183828397 22:40405545-40405567 ATTAGCAAAAGCCTCTTGGGGGG - Intronic
1184125638 22:42484696-42484718 ATCAGCAAGGACTTCAGAGGTGG + Intergenic
1184329640 22:43819217-43819239 TTTACCAAGGACCTTAGGGGGGG - Intergenic
1203284631 22_KI270734v1_random:148599-148621 ATGTGCAAGGACTTCATGGGCGG - Intergenic
950580079 3:13856167-13856189 GTTAGCAGGGACACCATGGGTGG - Intronic
951256577 3:20457127-20457149 TTTAGCCAGGACCTCATGGTGGG + Intergenic
952596095 3:35019301-35019323 ATTACAAAGGACCTCCTGGTAGG + Intergenic
952625976 3:35404221-35404243 AAAAGCAAGGACCTCATGACAGG + Intergenic
952855404 3:37766365-37766387 AGTTTCAAGGACTTCATGGGAGG - Intronic
953097207 3:39789953-39789975 TGTAGGAGGGACCTCATGGGAGG + Intergenic
954967737 3:54626003-54626025 CTTAGCAAGGAAATCATGGGTGG + Intronic
956434099 3:69216326-69216348 ATAAGCAAGGACTTCCTTGGTGG - Exonic
960023605 3:112984059-112984081 AATAGGCAGGATCTCATGGGTGG - Intergenic
961181337 3:124880504-124880526 ATTTGCAAGGACCAGGTGGGAGG + Intronic
963687499 3:148455655-148455677 AGTAGAAATGACCTCATAGGCGG + Intergenic
969920642 4:10536399-10536421 TTTAGCAGGGCCCACATGGGTGG - Intronic
970399654 4:15705011-15705033 ACTAGCATGGACCTCAAGAGGGG + Intronic
975457381 4:74608187-74608209 ATTAGCAAGGAGTTCATTGTTGG + Intergenic
977661283 4:99589740-99589762 ATTGGTAAGTACCTCATTGGTGG - Exonic
979812658 4:125058930-125058952 ATTCACAAGGACCACATTGGAGG - Intergenic
980833188 4:138156314-138156336 ACTAGCTATGACCTCATGGCAGG + Intergenic
985662801 5:1165710-1165732 CTTTGCAAGGAGCTCCTGGGTGG + Intergenic
987101485 5:14594901-14594923 AATAGGAAGGAACTCAAGGGAGG - Intronic
990443620 5:55871273-55871295 ACTAGAAAGGACCTCAAGAGTGG - Intronic
992359357 5:76020618-76020640 CTTTGCAAGGACCTGATGGTTGG + Intergenic
992800878 5:80294926-80294948 ATTAGCAAGGAAATCTTTGGGGG + Intergenic
993561142 5:89411034-89411056 ATCAGCAAAGACTTCATGGCAGG - Intergenic
1002697255 5:181099235-181099257 ATTTGGAATGACCTCATGGATGG - Intergenic
1003230168 6:4244621-4244643 TTAGGGAAGGACCTCATGGGAGG - Intergenic
1005645818 6:27837500-27837522 GTGAGCAAGGACCTCGTGGCCGG - Intergenic
1006678762 6:35782108-35782130 TTTAGCAAAGACCTAAAGGGAGG + Intronic
1008380707 6:50837003-50837025 ATTGGCAGGGACTTCAAGGGAGG - Intronic
1012928035 6:105287444-105287466 GTTAGCAAGGAGCTGATGGGAGG - Intronic
1021419219 7:20426106-20426128 CATAGGAAGGACCACATGGGGGG + Intergenic
1024976132 7:55115638-55115660 ATTTGCAGGGAGCTCATGGATGG - Intronic
1026120759 7:67534931-67534953 ATTATCAAGGACCCTATGGTAGG + Intergenic
1029623123 7:101702338-101702360 GTTAGCATGGAGCCCATGGGAGG + Intergenic
1030796752 7:113798180-113798202 ATCAGTAAGGATCTCCTGGGTGG - Intergenic
1034164123 7:149012782-149012804 ATTAGCCAGGAGCCCACGGGAGG + Intronic
1035791443 8:2309212-2309234 ATAAACAAGGAGCTCATGAGGGG + Intergenic
1035801362 8:2412493-2412515 ATAAACAAGGAGCTCATGAGGGG - Intergenic
1042164224 8:65930161-65930183 AATAGGAAGGAGCACATGGGAGG - Intergenic
1042859360 8:73297000-73297022 ATTCCCAAAGACTTCATGGGAGG + Intronic
1043638348 8:82414849-82414871 ATTATCAAGAACCTTATGGTAGG + Intergenic
1045166503 8:99612419-99612441 AGTAGTAAGGACCACATGGCTGG - Intronic
1045925896 8:107578587-107578609 ATTAGAAAGAATATCATGGGGGG - Intergenic
1046890131 8:119413935-119413957 ATTAGTTAGAACCTCATGGTTGG - Intergenic
1048346731 8:133581441-133581463 AATAGCAAAGGCCTCATGTGGGG - Intergenic
1049893106 9:89350-89372 ATCAGGAAGGACCCAATGGGTGG - Intergenic
1051232154 9:14965272-14965294 ATTAGGAAGAATATCATGGGGGG + Intergenic
1053508377 9:38666301-38666323 CTTAACAAGGACCTCAAAGGAGG - Intergenic
1053734320 9:41089403-41089425 ATCAGGAAGGACCCGATGGGTGG - Intergenic
1054694070 9:68342169-68342191 ATCAGGAAGGACCCGATGGGTGG + Intronic
1056575419 9:87852795-87852817 ATGAGCAATGACTTCCTGGGAGG + Intergenic
1060234188 9:121850823-121850845 ATTACCAAGGACGTGATGGTTGG - Intronic
1186926622 X:14339957-14339979 ATTAACAAGTACTTCATAGGCGG - Intergenic
1188369665 X:29353197-29353219 TTAAGCAAGAAACTCATGGGTGG + Intronic
1188440822 X:30214292-30214314 ATTTGCAAGGAGATCATGGAGGG + Intergenic
1189659860 X:43285669-43285691 TTGGGGAAGGACCTCATGGGAGG + Intergenic
1191586517 X:62833281-62833303 ATTAGGTGGGACCTAATGGGAGG - Intergenic
1192726475 X:73758504-73758526 ATTAGCAAGCACGTTTTGGGTGG - Intergenic
1197282077 X:124548881-124548903 ATTTGAAAGGACCACATGTGGGG - Intronic
1197687535 X:129457602-129457624 ATTAGCAAGGACCTAGTAGTAGG - Intronic
1198509779 X:137338727-137338749 CATAACAAGGACCTCATGGTAGG - Intergenic
1201156664 Y:11136791-11136813 ATTAGGAAGAATATCATGGGGGG + Intergenic