ID: 913554811

View in Genome Browser
Species Human (GRCh38)
Location 1:119954794-119954816
Sequence CTTGCTAATGACCCATATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913554806_913554811 -9 Left 913554806 1:119954780-119954802 CCTCCCATGAGGTCCTTGCTAAT 0: 1
1: 0
2: 2
3: 8
4: 110
Right 913554811 1:119954794-119954816 CTTGCTAATGACCCATATAAGGG No data
913554802_913554811 19 Left 913554802 1:119954752-119954774 CCAAAGATTCATACAATGAGTAT 0: 1
1: 0
2: 2
3: 16
4: 189
Right 913554811 1:119954794-119954816 CTTGCTAATGACCCATATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913554811 Original CRISPR CTTGCTAATGACCCATATAA GGG Intronic
No off target data available for this crispr