ID: 913555021

View in Genome Browser
Species Human (GRCh38)
Location 1:119957231-119957253
Sequence GACCTTGATGTATATACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913555021_913555023 8 Left 913555021 1:119957231-119957253 CCATGAGTATATACATCAAGGTC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 913555023 1:119957262-119957284 AGTTGCCTTATTTGTTAAACGGG 0: 1
1: 0
2: 14
3: 168
4: 1408
913555021_913555022 7 Left 913555021 1:119957231-119957253 CCATGAGTATATACATCAAGGTC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 913555022 1:119957261-119957283 CAGTTGCCTTATTTGTTAAACGG 0: 1
1: 3
2: 64
3: 779
4: 4162
913555021_913555025 30 Left 913555021 1:119957231-119957253 CCATGAGTATATACATCAAGGTC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 913555025 1:119957284-119957306 GTATAGTAGAACTTCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913555021 Original CRISPR GACCTTGATGTATATACTCA TGG (reversed) Intronic
904246228 1:29190072-29190094 GATCTTGCTGTACATAGTCAAGG + Intergenic
905180704 1:36164408-36164430 TCCCTTGTTGTATATAGTCATGG - Intronic
908907096 1:69028638-69028660 GCCCTTAATGTATAAACTCAAGG - Intergenic
910397071 1:86804133-86804155 GACCTTAACCTATATACTGATGG - Intergenic
912021665 1:105114045-105114067 GACCTTAACCTATATACTGATGG + Intergenic
913555021 1:119957231-119957253 GACCTTGATGTATATACTCATGG - Intronic
913973443 1:143434560-143434582 AACCTTGATGTATATATTTTAGG - Intergenic
914067832 1:144260167-144260189 AACCTTGATGTATATATTTTAGG - Intergenic
914111323 1:144706187-144706209 AACCTTGATGTATATATTTTAGG + Intergenic
917068650 1:171125185-171125207 CACCTTCATGTATATATTTATGG + Intergenic
918994398 1:191738172-191738194 AAACTTGATGTATATACTAGAGG + Intergenic
919666856 1:200300788-200300810 CACTTTGATTTATATTCTCATGG - Intergenic
921032002 1:211341940-211341962 GACATTGATGGAGAGACTCAGGG + Intronic
1065005553 10:21376665-21376687 TACCTGGATGTATAAACTTAAGG + Intergenic
1068165300 10:53323781-53323803 TACTTTGATGTATATCCTCAAGG + Intergenic
1068270994 10:54724032-54724054 TACCTTTGTGTAGATACTCAGGG - Intronic
1068500685 10:57837708-57837730 GACCTTAACCTATATACTGATGG + Intergenic
1073971129 10:109046296-109046318 GACCTTAATCTATATACCGATGG + Intergenic
1075146704 10:119888512-119888534 GACCTTAACCTATATACTGATGG + Intronic
1077742805 11:4866101-4866123 CACCAAGATGTGTATACTCATGG + Intronic
1079730817 11:23936555-23936577 GACCTTAACCTATATACTGATGG - Intergenic
1082261629 11:50080070-50080092 GCCCTTGATGTAAATGGTCAAGG - Intergenic
1084211398 11:67625039-67625061 GACCTTAACCTATATACTGATGG + Intergenic
1084214719 11:67641066-67641088 CACCTTGTTGTATAGCCTCAAGG - Intergenic
1085760790 11:79239514-79239536 GACCTGGATGCATGAACTCAAGG + Intronic
1086291293 11:85312966-85312988 GACCTAGATGTATATCCAAAAGG - Intronic
1086296823 11:85377560-85377582 GACTCTGTTGTATATACTCTAGG + Intronic
1088733161 11:112701619-112701641 GTCCTTTGGGTATATACTCAGGG + Intergenic
1088990468 11:114949209-114949231 GATCTTGATTTATTTACTCTAGG + Intergenic
1090506912 11:127325117-127325139 GAAGTTGAAGTATAAACTCATGG - Intergenic
1091769950 12:3145055-3145077 GACCTTGATGTGTGAAATCAAGG - Intronic
1094286494 12:28800014-28800036 GACCTACATGTGTATAATCAAGG - Intergenic
1100331944 12:93591310-93591332 GACCTTGATTTACATATACAAGG + Intergenic
1100332157 12:93593420-93593442 GACCTTGATTTACATATACAAGG + Intergenic
1100880046 12:99006391-99006413 GATCTTAATTAATATACTCAGGG - Intronic
1103649073 12:122419465-122419487 GGCCTTGATATATCTATTCAAGG + Intronic
1106975033 13:35201156-35201178 GACCTTAAAATATATACTCAGGG - Intronic
1108848982 13:54705253-54705275 GACCTTAACCTATATACTGATGG + Intergenic
1111673297 13:91356191-91356213 GATTTTGCTGTATATACTTAAGG + Intergenic
1112538780 13:100285809-100285831 GACCTTAACCTATATACTGATGG + Intronic
1115534138 14:34356851-34356873 TACCTAAATGTATATACACATGG + Intronic
1119660330 14:76446797-76446819 GAACCTGATGTATAAGCTCAGGG - Intronic
1120066613 14:80048338-80048360 TACATTGATATATATACTAAAGG + Intergenic
1122149078 14:99714784-99714806 AAATTTGATGTATATACACATGG + Intronic
1125063599 15:35455403-35455425 GACCATGCTGTATATACTGCTGG - Intronic
1126200215 15:45977024-45977046 GAGCTTGATATAAAGACTCATGG + Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1128540205 15:68523099-68523121 GACCTGGATGGCTATACTCTTGG - Intergenic
1129225638 15:74168905-74168927 GACCTTCATGTTCATCCTCAGGG - Intergenic
1131917528 15:97286308-97286330 GAGATTAATGTATATATTCATGG + Intergenic
1135465128 16:22678299-22678321 GATCCTAATGGATATACTCAGGG - Intergenic
1136124402 16:28167167-28167189 GAGCTTGGTGTATATAGTCAAGG - Intronic
1136271206 16:29149283-29149305 GTCGTAGATGTATATATTCATGG + Intergenic
1139710961 16:68775783-68775805 GACCTTGATGTCTAATTTCAGGG - Intronic
1140069595 16:71637684-71637706 TACCATGATGTTTATAATCAGGG - Intronic
1141810578 16:86372871-86372893 GACCTTGCTGTATAACCTCGAGG - Intergenic
1142074819 16:88111273-88111295 GTCGTAGATGTATATATTCATGG + Intronic
1155872532 18:31045175-31045197 GACTTAGATTAATATACTCATGG - Intergenic
1159017429 18:63112699-63112721 GAGCTTGCTATATATACTAAGGG - Intergenic
1162108284 19:8384472-8384494 GACCTTAACCTATATACTGATGG + Intronic
925949506 2:8897690-8897712 GACCTTAACCTATATACTGATGG - Intronic
927763597 2:25783371-25783393 AACCTGAATTTATATACTCATGG + Intronic
930038923 2:47105610-47105632 GACCTTAACCTATATACTGATGG + Intronic
930438017 2:51371415-51371437 ACCCTGGAAGTATATACTCAAGG + Intergenic
933096216 2:78185491-78185513 GACATTGATTTATATACAAAGGG - Intergenic
933544082 2:83687449-83687471 GACAGTGTTGTATTTACTCATGG + Intergenic
934178139 2:89595527-89595549 AACCTTGATGTATATATTTTAGG - Intergenic
934288438 2:91669818-91669840 AACCTTGATGTATATATTTTAGG - Intergenic
934632831 2:95948657-95948679 GACCTGCATGTATAGACTGACGG - Intronic
934800667 2:97154592-97154614 GACCTGCATGTATAGACTGACGG + Intronic
936802437 2:116284995-116285017 GACCTTAAGCTATATACTGATGG + Intergenic
936877994 2:117215387-117215409 GAGCTTGACATATATCCTCAGGG + Intergenic
941243640 2:163070833-163070855 GACCTTAATCTATATACCGATGG + Intergenic
943134131 2:183890454-183890476 GACCTTAACCTATATACTGATGG + Intergenic
943902136 2:193454372-193454394 GACCTTAACCTATATACTGATGG + Intergenic
943971475 2:194413409-194413431 TTTCTTGATGTACATACTCAAGG + Intergenic
944958242 2:204837608-204837630 AAGCTGGATGTATACACTCAGGG - Intronic
946206423 2:218112165-218112187 GACCTTAATGTATATACCAATGG - Intergenic
1170420777 20:16190973-16190995 GTGGTTGATGTAAATACTCATGG - Intergenic
1171270870 20:23815882-23815904 GACCTTAACCTATATACTGATGG + Intergenic
1173779080 20:45738523-45738545 GAGCTTGTTGTATATATTTATGG - Intergenic
1174858566 20:54069158-54069180 GCCCTGGGTGTATATACTCAGGG - Intronic
1178660194 21:34501374-34501396 GAACTTGAGGTATACATTCATGG + Intergenic
1181364919 22:22368843-22368865 GACCTTGATGACCATCCTCATGG + Intergenic
1184415689 22:44350647-44350669 GACCTTGAAGAAGAGACTCAGGG + Intergenic
951608258 3:24461730-24461752 GACTATGATGTCTATACTAAGGG + Intronic
951614313 3:24524374-24524396 TAGCTAGATGTATTTACTCATGG + Intergenic
952453417 3:33451660-33451682 GACCTTAACCTATATACTGATGG + Intergenic
955069397 3:55559682-55559704 GACATTGATGGATAGACTGAGGG - Intronic
955196080 3:56806058-56806080 GACCTTAACCTATATACTGATGG - Intronic
955894374 3:63683919-63683941 GACCTTCATCTATATAAACAAGG + Intergenic
958548859 3:95590447-95590469 GACCTTAACCTATATACTGATGG - Intergenic
963182766 3:142377176-142377198 AACCTTAATTTATATACTTAAGG + Intronic
967521230 3:190435288-190435310 GACCATGATGTAGAGACACAAGG - Intronic
967742600 3:193019804-193019826 TACCTTGATTTATAAACTCTCGG - Intergenic
969831110 4:9797866-9797888 AACCTTGATGTATATATTTTAGG + Intronic
971612435 4:28743061-28743083 GACCTTTATGTAAAGACTAAAGG + Intergenic
971958325 4:33452727-33452749 CAACTTGATGTATAGATTCAGGG + Intergenic
974187699 4:58463112-58463134 GACCTTAACCTATATACTGATGG + Intergenic
974537486 4:63189653-63189675 GACCTTAACCTATATACTGATGG + Intergenic
984240118 4:177208305-177208327 GACTTTGATGTCTATACTACTGG + Intergenic
985166111 4:187095808-187095830 GAACATGTTGTAGATACTCAGGG + Intergenic
987818234 5:22931118-22931140 GACCTTAACCTATATACTGATGG + Intergenic
989711764 5:44406676-44406698 CAACTTGATCTATATACTCAAGG + Intergenic
991012110 5:61894584-61894606 GACCATGTTGAATAGACTCATGG - Intergenic
995460329 5:112396520-112396542 CAGCTTGATGTAGATACTCCTGG - Intronic
995583061 5:113620781-113620803 GACCTTAACCTATATACTGATGG - Intergenic
996413363 5:123182926-123182948 GACCTGGTTGTATACACTAAAGG - Intronic
1001593029 5:172879396-172879418 GACCTTCCTGTACATTCTCATGG + Intronic
1003187654 6:3846901-3846923 GAGCTTGATGGAGATGCTCAAGG - Intergenic
1007030393 6:38621424-38621446 GACCTTAACCTATATACTGATGG + Intronic
1009385609 6:63081774-63081796 GACCTTAACCTATATACTGATGG - Intergenic
1016184371 6:141181181-141181203 GACCTTAATCTATATACCGATGG + Intergenic
1017101316 6:150852066-150852088 GACCTTAACCTATATACCCATGG + Intergenic
1017919619 6:158859938-158859960 GATCTTGATGGTTATACTGAGGG - Intergenic
1017996612 6:159537091-159537113 GAAATTGTGGTATATACTCAAGG + Intergenic
1019787966 7:2991186-2991208 GACCCCTATGTATTTACTCAAGG + Intronic
1020712546 7:11626344-11626366 GACCTTGATGAAAATGATCAAGG - Intronic
1021811615 7:24407263-24407285 GACCATGTGGTAAATACTCAAGG + Intergenic
1022177583 7:27886639-27886661 GAACATGATGTATACACACATGG - Intronic
1022564089 7:31379607-31379629 TACATTGATGTATATATTAAGGG - Intergenic
1027203287 7:76076376-76076398 GTCCTTGATGTAAATTGTCAAGG - Intergenic
1028341260 7:89722745-89722767 GACTTTGAAGTATATATTTATGG - Intergenic
1028494880 7:91451305-91451327 GACCTTAACCTATATACTGATGG - Intergenic
1032102279 7:128991396-128991418 AACATCGATTTATATACTCATGG + Intronic
1033949534 7:146766778-146766800 GACCTTGATGAATATACAGATGG - Intronic
1037394668 8:18429351-18429373 TACCATGATGTATATACATAGGG + Intergenic
1039692828 8:39880469-39880491 GACCTTAACCTATATACTGATGG - Intergenic
1039819698 8:41124784-41124806 GACTTTGAAGAACATACTCAGGG - Intergenic
1040527965 8:48240970-48240992 GACCTTAACCTATATACTGATGG + Intergenic
1040953751 8:52959686-52959708 GACCTTAACCTATATACTGATGG + Intergenic
1041352217 8:56958681-56958703 GAACTAGATGTATATGCACAAGG - Exonic
1041938254 8:63358361-63358383 CAGCTTGATGTATATCCCCATGG + Intergenic
1042919959 8:73911013-73911035 GACCTTAACCTATATACTGATGG + Intergenic
1046883849 8:119340824-119340846 GACCTTGCTCTATAACCTCAGGG - Intergenic
1058975820 9:110124645-110124667 GACACTGATGTCTCTACTCAAGG + Intronic
1187776880 X:22770311-22770333 GACCTTGCTTTATATATGCATGG - Intergenic
1187779339 X:22800316-22800338 TACTTTGATGTATATAATCAAGG + Intergenic
1191780465 X:64858684-64858706 GACCTTGATGGCTGTACTCAAGG + Intergenic
1195150406 X:102062364-102062386 GACCTAGATCTGTATATTCAAGG - Intergenic
1195850813 X:109279925-109279947 GACCTTAACCTATATACTGATGG - Intergenic
1196127023 X:112111772-112111794 GACCTTAACCTATATACTGATGG - Intergenic
1196306539 X:114109312-114109334 GACCATGATGTATCTACTTAAGG - Intergenic
1197948454 X:131866879-131866901 GATTTTGGTGTCTATACTCATGG + Intergenic
1199486560 X:148354705-148354727 GACATAGATGTATATATTTATGG - Intergenic
1200776530 Y:7174801-7174823 GACCTTAACCTATATACTGATGG + Intergenic
1201472872 Y:14352898-14352920 GACCTTGACCTATATACCGATGG - Intergenic
1201487909 Y:14511345-14511367 GACCTTAATCTATATACCGATGG + Intergenic
1201907960 Y:19104481-19104503 GACCTTAACCTATATACTGATGG - Intergenic
1201911349 Y:19136474-19136496 GACCTTAACGTATATACTGATGG + Intergenic