ID: 913558065

View in Genome Browser
Species Human (GRCh38)
Location 1:119989141-119989163
Sequence ATGCAATAGCTGAGTGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913558063_913558065 10 Left 913558063 1:119989108-119989130 CCAAACTGTCTAGGCTCAACTCT 0: 1
1: 0
2: 1
3: 16
4: 167
Right 913558065 1:119989141-119989163 ATGCAATAGCTGAGTGAATATGG 0: 1
1: 0
2: 1
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913558065 Original CRISPR ATGCAATAGCTGAGTGAATA TGG Intronic
900350213 1:2230790-2230812 ATGCAATAGCTGAATTAATTAGG - Intronic
904587554 1:31588598-31588620 ATGGAATGACTGAGTGGATATGG + Intergenic
908912282 1:69085931-69085953 ATGCACTAGCTGTGTGAATTGGG - Intergenic
909049399 1:70750474-70750496 AAGCAAATGCTGAGGGAATATGG - Intergenic
910352000 1:86308466-86308488 ATGCAAAAGCTGGGTGATTTTGG + Intergenic
910534611 1:88283008-88283030 ATCAAATAGCTCAGTGAAAATGG + Intergenic
911378576 1:97083364-97083386 ATGCAATACCAAAGAGAATATGG - Intronic
911386200 1:97178458-97178480 AGGCAAGAGATGAGTGAAGAGGG + Intronic
912416506 1:109511816-109511838 ATGCAATTCCTGATTCAATATGG + Intergenic
912639011 1:111326210-111326232 ATTCAACAGCAGAGTGACTATGG - Intergenic
913558065 1:119989141-119989163 ATGCAATAGCTGAGTGAATATGG + Intronic
913570379 1:120114041-120114063 ATGTATTAGCTGACTAAATAAGG - Intergenic
914291183 1:146275018-146275040 ATGTATTAGCTGACTAAATAAGG - Intergenic
914552227 1:148725801-148725823 ATGTATTAGCTGACTAAATAAGG - Intergenic
914576866 1:148980063-148980085 CTGCAATAGCTGTGTGAAACAGG - Intronic
915227068 1:154419111-154419133 ATGCATGAGCTGTGTGAATTTGG + Intronic
915271900 1:154759395-154759417 ATGGAAAAGCTGACAGAATATGG + Intronic
920615605 1:207489693-207489715 TTGCAATCACTGAGTGATTATGG - Exonic
921139575 1:212293981-212294003 AAGCAAAACCTGAGAGAATAAGG - Intronic
922040536 1:221891897-221891919 ATGCAATATCAGGGTGAACAAGG + Intergenic
1064709312 10:18107474-18107496 ATGCAAGAGCAGACTGAAGAGGG - Intergenic
1066448847 10:35509843-35509865 CTGTATTAGCTGTGTGAATAAGG + Intronic
1069078518 10:64063897-64063919 ATGCAATGACTGAGTGGAGAAGG + Intergenic
1070855553 10:79605767-79605789 ATGAAATAGCTGAGGGAAACGGG - Intergenic
1071400511 10:85264388-85264410 ATGCAAAAGTAGAGAGAATAGGG - Intergenic
1078647415 11:13154060-13154082 ATGCATTAGCTGTGTTATTATGG - Intergenic
1080043971 11:27789090-27789112 ATGGAATAGGTGAGAGAAAATGG - Intergenic
1080652836 11:34236273-34236295 TTGAAATAGCTGAGAAAATATGG + Intronic
1081222256 11:40476220-40476242 ATGCCATACATGAGTGTATATGG - Intronic
1081478898 11:43465188-43465210 ATTCAATAGCTGACTGAATTTGG - Intronic
1081729283 11:45357685-45357707 CTGCAATAACTGGGTGAAGAGGG - Intergenic
1083009053 11:59377085-59377107 TTGCAAGAGCTGACTGACTATGG + Intergenic
1083884253 11:65563815-65563837 ATGCACCAGCTAAGTGAATTGGG + Intergenic
1084162714 11:67358655-67358677 ATGTTATTGCTGAGTGAGTAGGG - Intronic
1085772379 11:79337010-79337032 ATGCAATAGCCGAGGGGACAAGG + Intronic
1086002389 11:81998720-81998742 ATGAAATAGCTGAGGGAAACAGG - Intergenic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088241528 11:107778252-107778274 ATGTAATAGCTGATTGAGTGAGG + Intergenic
1088493362 11:110407855-110407877 ATAAATTAGCTGAGTAAATATGG + Intergenic
1091403403 12:194597-194619 ATGCATTGGCTCAGTGAATCGGG + Intronic
1092204144 12:6605640-6605662 ATGTAATAGCCTAGTGAAGAGGG - Intronic
1092881117 12:12888553-12888575 GTGGAATAGCTGAGTGATTCTGG - Intergenic
1093635907 12:21466940-21466962 ATACAATAGATGAATTAATACGG + Intronic
1096266337 12:50125662-50125684 ATGCAATTACTGAGGGGATAAGG - Intergenic
1097358029 12:58623983-58624005 ATGTAAAAGCTAAGTGAACAAGG - Intronic
1098831548 12:75370979-75371001 ATGCAATAGCTGAGGGAAGCTGG - Intronic
1101551728 12:105769224-105769246 TTGCAATAACTTAGTGAAGAAGG + Intergenic
1101971364 12:109315244-109315266 ATTCTATAGCTGATTGAATTTGG + Intergenic
1104037983 12:125111519-125111541 ATGCAAGAGCCCAGTGAAGATGG - Intronic
1104653073 12:130551426-130551448 ATGCAACATCTGAGTGCCTATGG - Intronic
1107046666 13:36000118-36000140 ATGGAAGAACTGAGGGAATAGGG - Intronic
1108493936 13:51006220-51006242 GTGTAATAGCTGTGTAAATAAGG + Intergenic
1108977709 13:56469450-56469472 ATGTAATGGGTTAGTGAATATGG + Intergenic
1109103904 13:58223879-58223901 ATGCAACAGGTGGGTTAATATGG - Intergenic
1110530462 13:76591199-76591221 ATGCAATAGCTAAGTCATTATGG - Intergenic
1111220607 13:85200426-85200448 ATGCAAAAGCTCAGAGAGTAAGG - Intergenic
1111632877 13:90865631-90865653 ATGCAGTGGCTGAGAGAATGTGG + Intergenic
1114204324 14:20554444-20554466 TTGAAATGTCTGAGTGAATAAGG - Intergenic
1116902640 14:50376576-50376598 ATGTTATTGCTGAGTGAAGAAGG + Intronic
1118753954 14:68824711-68824733 ATGCAAGACCTGAGTGCACAGGG - Intergenic
1122999525 14:105285496-105285518 ATGCAAACGCTGACTCAATATGG + Intronic
1124798634 15:32807687-32807709 TTGCAATACCTCTGTGAATATGG + Intronic
1125101855 15:35922909-35922931 ATGCAATAACTGAATGATTAGGG + Intergenic
1126375424 15:47992215-47992237 ATCCAACAGCTGAGTGTATGGGG + Intergenic
1128707593 15:69848793-69848815 AAGCAATAGCTTAGTGAAACAGG + Intergenic
1130151308 15:81313677-81313699 AAGCATTTGCTGAGTGAATCGGG - Intronic
1131947131 15:97635884-97635906 ATTAAAAAGGTGAGTGAATAAGG - Intergenic
1135579919 16:23616698-23616720 ATGAAATGTCTCAGTGAATATGG + Intronic
1135844444 16:25905905-25905927 AAGCCATAGCTGAGTGTTTATGG + Intronic
1136612455 16:31374792-31374814 AAACCATAGCAGAGTGAATAAGG - Intronic
1137465503 16:48705054-48705076 AGGCCATAGCTCAGTGATTAGGG + Intergenic
1137738861 16:50745294-50745316 AGGCAGAAGCTGAGTGAATGTGG + Intronic
1138476777 16:57275245-57275267 ATGCAACAGCTCTGTGTATAAGG - Intronic
1139188710 16:64837002-64837024 ATGCCATAGGTTTGTGAATAAGG - Intergenic
1139216586 16:65131445-65131467 ATGAAAGAGGTGAGTGAATAAGG - Intergenic
1140959820 16:79900925-79900947 CTGCAATAGCTGAAAGAACATGG - Intergenic
1144301727 17:13927639-13927661 ATGAAATAGCTGAGGGAAATGGG + Intergenic
1146513240 17:33468948-33468970 ATGCAACAAGTTAGTGAATAAGG + Intronic
1147465980 17:40611199-40611221 ATCCAATAGGTGATTCAATAGGG + Intergenic
1148250308 17:46072684-46072706 AGGCAATAACTTAGTGAAAATGG - Intronic
1148567168 17:48640360-48640382 ATGGAATAAGTGAGTCAATAAGG + Intergenic
1155121247 18:22821544-22821566 ATTCAATAACTCAGTGAATATGG - Intronic
1159907179 18:74104920-74104942 AATCAATGGCTGAATGAATAAGG + Intronic
1162854892 19:13460661-13460683 TTGCTGTAGCTGAGTGACTAAGG - Intronic
926886090 2:17600166-17600188 ATACACTAGCAGTGTGAATATGG + Intronic
928612267 2:33002275-33002297 ATGCAAGGGGTGAGTTAATAAGG + Intronic
933480560 2:82851775-82851797 ATGCAGCAGCTGAGAGAAAAAGG + Intergenic
933966636 2:87435183-87435205 ATGCATTAGCTGAATGTTTATGG - Intergenic
938689378 2:133773190-133773212 AGGCAATTGCTGATAGAATAAGG + Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939678322 2:145099459-145099481 ATGTACTAGCTGAGTGAACCAGG + Intergenic
939939805 2:148335906-148335928 ATGCACTAGCTGTATGAATTTGG - Intronic
941066265 2:160906460-160906482 ATGTAATATGTGTGTGAATATGG + Intergenic
941158413 2:162006448-162006470 ATGGAGTAGCTGAGCCAATATGG - Intronic
941418305 2:165249530-165249552 ACGCCTTAGCTTAGTGAATAAGG + Intronic
941555378 2:166973045-166973067 ATTAAATAGCTGAGTAAATCTGG + Intronic
946429846 2:219619702-219619724 ATGCAGTAGATGAGGGAACAAGG - Intergenic
946792288 2:223313345-223313367 ATGCAATAGTTTAATGAATATGG + Intergenic
1170092804 20:12609794-12609816 ATAAAATATCTGAGTCAATATGG - Intergenic
1170982848 20:21231030-21231052 ATGCAAAAGATGAGTAAATTTGG + Intronic
1172005512 20:31816707-31816729 ATTCACTAGCTGAGTGACTGTGG + Intergenic
1172210645 20:33195711-33195733 AGGCAAAAGCTGGGTGAATATGG + Intergenic
1173168407 20:40702370-40702392 ATGCACTAGCAGAGAGCATAGGG - Intergenic
1177696381 21:24578540-24578562 ACGAAATAGCTGTGTGAACATGG + Intergenic
1178373312 21:32045929-32045951 ATGCAATGGCAGAGAGAAAATGG + Intergenic
1182645928 22:31809359-31809381 ATTCAATTGCAGAGAGAATAAGG - Intronic
951390099 3:22092079-22092101 ATTGAATAGAAGAGTGAATATGG + Intronic
952477847 3:33729633-33729655 ATTCAATAGCAGGGTGAACATGG - Intergenic
953774787 3:45807190-45807212 TTGGAATAGCTCAGTGAAGAAGG - Intergenic
958825415 3:99024136-99024158 ATGTGGTAGCTGAGTGAATTAGG + Intergenic
959623467 3:108423729-108423751 ATTTAATAGCTGTGTGAATTTGG - Intronic
959693339 3:109223205-109223227 ATGGAATTGCTGAGTGGAAATGG - Intergenic
959778700 3:110202159-110202181 ATGGGATAGCTGGGTGAAAATGG + Intergenic
960230839 3:115225439-115225461 ATGCATTACCTGAGTGATTCAGG + Intergenic
960720149 3:120617666-120617688 AAGAAATAGCTGAGTAATTAGGG - Intergenic
961430511 3:126879173-126879195 AACCAATAGCTGAATAAATAGGG - Intronic
962375882 3:134858382-134858404 CTGCCATAGCTGAGTAAACAGGG + Intronic
963357450 3:144227485-144227507 ATGCAAAAGTTAAGTGAAAATGG + Intergenic
964809977 3:160652947-160652969 ATTCAAAAGCAGAGTGAAAATGG + Intergenic
965092778 3:164183342-164183364 ATGCAAGAGCTGAGTTCAAAAGG + Intergenic
965298580 3:166979950-166979972 ATGGAATAAATGAATGAATAAGG + Intergenic
965822764 3:172701274-172701296 CTGGAATAGCTGGGTGAATGGGG - Intronic
968719392 4:2189221-2189243 ATAGAATAGCTGAATGGATAAGG + Intronic
973287084 4:48430722-48430744 ATTCAACAGCTGACTGAAGATGG + Intergenic
975736143 4:77383010-77383032 AGGCGATAGCTGAGTGCAAAGGG - Intronic
977245396 4:94624717-94624739 ATGCAAAAACTGAGAGAATTTGG + Intronic
978905920 4:114005357-114005379 ATGGAATATCTGAATGAATGAGG + Intergenic
980189116 4:129500915-129500937 ATGAAATAGCTAAGTCAAAAGGG + Intergenic
980461474 4:133120662-133120684 ATGTACTAGATGAGTGAAAAAGG - Intergenic
981644636 4:146985235-146985257 AGGGAATAGCTGAGTGTAAAGGG - Intergenic
982365896 4:154578142-154578164 ATGAAAAAGATGAGTGAATTTGG + Intergenic
982997402 4:162367043-162367065 ATTCAATAGCTGAGTTAATATGG + Intergenic
983428358 4:167616316-167616338 CTGCAATAGATAAATGAATAAGG - Intergenic
986412670 5:7496491-7496513 ATATAATAGCTGAATGAATTCGG + Intronic
989006973 5:36826140-36826162 AGGCAATAGCTGAATTAATCAGG + Intergenic
989521585 5:42408492-42408514 ATTAAATATATGAGTGAATAAGG + Intergenic
990698345 5:58447235-58447257 AGGCACCAGCTGAGTGAATCAGG + Intergenic
990821505 5:59845717-59845739 GTGCATTAGCTGTGTGGATATGG + Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
993725769 5:91364931-91364953 ATGAAATAAATGAATGAATATGG - Intergenic
994345444 5:98680158-98680180 CTCCAATAGGTGAGAGAATAAGG - Intergenic
998938462 5:147255724-147255746 ATGGAATAGCTGAGCAATTAGGG - Intronic
999168667 5:149574047-149574069 ATGAAATATCTGAGTGAAAATGG + Intronic
1000387310 5:160687054-160687076 CTGCATTACCTGAGTGAAAAGGG - Intronic
1000486967 5:161858713-161858735 ATGCTATAGCTGAAGGAATGAGG + Intronic
1000687912 5:164275415-164275437 ATGAAATACTTAAGTGAATATGG - Intergenic
1007357674 6:41333074-41333096 CTGAAATAGCTGAGTGACTGTGG + Intergenic
1007880370 6:45158714-45158736 ATAAAATAGGTGAGTGAGTAGGG - Intronic
1007895724 6:45355565-45355587 ATGCTACATCTGAGTGATTAAGG - Intronic
1009715102 6:67381090-67381112 ATGCAATAGCTGGGAGAATGAGG + Intergenic
1014291177 6:119560618-119560640 GTGCAATGGCTGAGTGAAAAAGG + Intergenic
1014879714 6:126708496-126708518 CTTGAATAGCTGAGTGAATTGGG + Intergenic
1015550753 6:134410150-134410172 ATGCAAGAGCTGTGAGAACATGG - Intergenic
1016540631 6:145159963-145159985 ATGCAATAGATGAGCTCATATGG - Intergenic
1020502524 7:8941447-8941469 AAGCATTAGCTGGGTTAATATGG - Intergenic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1021779179 7:24085049-24085071 AAGCAATATCTCAGGGAATAGGG - Intergenic
1023436177 7:40142845-40142867 AAGGAATAGCTGAGTAATTAGGG - Intronic
1027569867 7:79851861-79851883 ATGCTATACATGTGTGAATACGG + Intergenic
1027683798 7:81255531-81255553 ATGCAAAGGCAAAGTGAATAAGG + Intergenic
1032696670 7:134342660-134342682 GTGCAACAGCTCAGTGAGTAAGG + Intergenic
1033575975 7:142685307-142685329 ATGCAATATCTAAGAGAATATGG - Intergenic
1035851047 8:2919621-2919643 ATGCAAATGCTGAGGGAATTAGG - Intergenic
1036081545 8:5562053-5562075 GTGCAATGGATGAATGAATAAGG + Intergenic
1042208293 8:66351183-66351205 ATGCAAGGGCTGAATGATTACGG - Intergenic
1044856426 8:96480820-96480842 ATTCACTAGCTGAGTCAATTTGG + Intergenic
1046775625 8:118160669-118160691 ATACAAAAGTTGAGTGAAAATGG + Intergenic
1048377723 8:133837260-133837282 ATGCAACAGCTCTGTGAATGTGG + Intergenic
1048829247 8:138460012-138460034 ATGCAAAAGCACTGTGAATAAGG + Intronic
1052456885 9:28710908-28710930 AACAAATAGATGAGTGAATATGG + Intergenic
1053269142 9:36738352-36738374 ATCCACTTGCTGAGTGAAAAGGG + Intergenic
1054796322 9:69305794-69305816 ATGCTGTAGCTTAGTGACTAAGG - Intergenic
1055484468 9:76744291-76744313 AAGCACTAGATGAGTGACTAGGG + Intronic
1186906601 X:14117702-14117724 ATGCACTTACTGAGTGAAAAGGG + Intergenic
1188906473 X:35798207-35798229 ATTCAATATCGGAGTGAACAGGG + Intergenic
1189147417 X:38669393-38669415 ATACATTAGCTGTGTGAATTTGG - Intronic
1193879821 X:86908304-86908326 ATGCAAGAGCTGTGTGAGCAAGG - Intergenic
1194897516 X:99463116-99463138 ATGGCAAAGCTGATTGAATATGG - Intergenic
1195555026 X:106211767-106211789 ATGCTATAAATGAATGAATAAGG - Intergenic
1197048634 X:122030927-122030949 ATTCATTAGCTGTGTGACTATGG + Intergenic
1197156467 X:123275329-123275351 ATTCAATAGTTGTGTGAATCTGG - Intronic
1199861674 X:151806571-151806593 ATCCACTAGCTGGGTGATTAGGG - Intergenic
1201553419 Y:15242888-15242910 ATGAATTTGCTGAGTGAAAATGG + Intergenic
1201852025 Y:18495523-18495545 ATGAAATAGCTGAGTCATTTGGG + Intergenic
1201881296 Y:18824857-18824879 ATGAAATAGCTGAGTCATTTGGG - Intronic