ID: 913560815

View in Genome Browser
Species Human (GRCh38)
Location 1:120017572-120017594
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 5, 1: 0, 2: 2, 3: 17, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913560812_913560815 -10 Left 913560812 1:120017559-120017581 CCTTAAAAAGACCCTATAAATAC 0: 5
1: 0
2: 2
3: 12
4: 243
Right 913560815 1:120017572-120017594 CTATAAATACACTTGAAGTTTGG 0: 5
1: 0
2: 2
3: 17
4: 227
913560810_913560815 -8 Left 913560810 1:120017557-120017579 CCCCTTAAAAAGACCCTATAAAT No data
Right 913560815 1:120017572-120017594 CTATAAATACACTTGAAGTTTGG 0: 5
1: 0
2: 2
3: 17
4: 227
913560811_913560815 -9 Left 913560811 1:120017558-120017580 CCCTTAAAAAGACCCTATAAATA 0: 5
1: 1
2: 3
3: 42
4: 375
Right 913560815 1:120017572-120017594 CTATAAATACACTTGAAGTTTGG 0: 5
1: 0
2: 2
3: 17
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900560224 1:3301413-3301435 CAATAAATGCATTTGTAGTTGGG + Intronic
902742948 1:18452631-18452653 CTATGAAGACTCTAGAAGTTGGG - Intergenic
905705860 1:40057041-40057063 CTATAAATACAAATGAAATATGG + Intronic
906028206 1:42693848-42693870 CTATAAATACACAGAAACTTTGG + Intronic
906496727 1:46309844-46309866 CTATAGATCTACTTCAAGTTTGG + Intronic
907191529 1:52653038-52653060 ATATAAATACAATTGATGTTTGG - Intronic
908068395 1:60432721-60432743 CTCTAAATACAGTTGCAGTTTGG - Intergenic
908724460 1:67160330-67160352 CTGAGAATGCACTTGAAGTTTGG + Intronic
909041952 1:70664558-70664580 TTATATATACACTGGAAGTGAGG - Intergenic
910278790 1:85475754-85475776 CCATAAAGCCACTAGAAGTTTGG - Intronic
911108726 1:94161004-94161026 CTAAAAATAAACTGGAATTTAGG + Intronic
911157347 1:94650292-94650314 CTACAAAGATACTTGAACTTTGG - Intergenic
912780174 1:112539130-112539152 CTATATATACATTTAAAGCTTGG - Intronic
913560815 1:120017572-120017594 CTATAAATACACTTGAAGTTTGG + Intronic
913637312 1:120776030-120776052 CTATAAATACACTTGAAGTTTGG - Intergenic
914281398 1:146176985-146177007 CTATAAATACACTTGAAGTTTGG + Intronic
914542443 1:148627920-148627942 CTATAAATACACTTGAAGTTTGG + Intronic
914624190 1:149443323-149443345 CTATAAATACACTTGAAGTTTGG - Intergenic
917540323 1:175906337-175906359 ATATATATACACTTTAAGTCTGG + Intergenic
921901376 1:220455133-220455155 CTATAAATTCACTTATAGCTTGG + Intergenic
923891047 1:238215167-238215189 CTATAAAGATACTTGAACATGGG - Intergenic
923993355 1:239464540-239464562 ATATAAGCATACTTGAAGTTTGG + Intronic
1063330142 10:5150207-5150229 CTTTAAATACACTTGCAGAAAGG - Intergenic
1065376269 10:25046092-25046114 CTATATATCCTCTTGCAGTTTGG - Intronic
1065858589 10:29851090-29851112 CTATAGATGAACTTGAAGTAAGG - Intergenic
1067345170 10:45433057-45433079 CTCTAACTACAGGTGAAGTTAGG - Intronic
1067958705 10:50822985-50823007 CTATAAATACACATGGAATAAGG + Intronic
1068361587 10:55980695-55980717 CTATAAATACATTAGAATGTAGG - Intergenic
1068388617 10:56362554-56362576 CTATAAATACTGCTGAAGTTTGG - Intergenic
1069065776 10:63940503-63940525 AGATAATTACACTTCAAGTTGGG - Intergenic
1069449799 10:68507495-68507517 CTATTAATACTCTTTAAGTGTGG + Intronic
1069596519 10:69675437-69675459 CTATAAGAACATTTGAAATTGGG + Intergenic
1070138490 10:73717391-73717413 CTATAAGTTCATTTGAAGTGTGG - Intergenic
1072864779 10:99047056-99047078 CTATAATATCATTTGAAGTTGGG - Intronic
1074629029 10:115229064-115229086 GTAGAAATATAATTGAAGTTGGG - Intronic
1075919530 10:126198791-126198813 TCATAAATACACATGAAATTTGG - Intronic
1078615410 11:12860780-12860802 TTATAAATACAGTTACAGTTTGG + Intronic
1079577740 11:22024574-22024596 GTATCAATAAACTTGAAGTTAGG - Intergenic
1080226154 11:29963124-29963146 CAATAAATACACTGCAAGTAGGG - Intergenic
1080262746 11:30367114-30367136 CTATCAATTCACTTGTTGTTTGG - Intergenic
1080306897 11:30846247-30846269 CTATCATCACACTTGAAATTTGG - Intronic
1081363911 11:42212448-42212470 TTATAAATATACCTGAAGATGGG + Intergenic
1082702681 11:56452669-56452691 CCACAAATTCACTTGAAATTTGG - Intergenic
1082703784 11:56467179-56467201 CCACAAATTCACTTGAAATTTGG + Intergenic
1082965010 11:58958232-58958254 CTCCAAATACATTTGGAGTTGGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084532255 11:69734420-69734442 CTATAAATACCCCAAAAGTTTGG - Intergenic
1085976727 11:81664098-81664120 CCATAAATACTCATGAGGTTTGG + Intergenic
1086048815 11:82565021-82565043 CTATAAATAGAGCTGAAGTTTGG - Intergenic
1086169243 11:83816860-83816882 TTATAAATATTCTTCAAGTTTGG + Intronic
1086527643 11:87747320-87747342 CTAAAAAGAAACTTGGAGTTAGG - Intergenic
1087500632 11:98948742-98948764 AAATGAATACACTTGTAGTTTGG + Intergenic
1087528030 11:99342774-99342796 GTATAATAACACTTGAATTTGGG - Intronic
1087695424 11:101370421-101370443 CTATCAATACCCCTGAAGTTAGG - Intergenic
1088881037 11:113973494-113973516 CTATAAATTCTCTAAAAGTTTGG + Intergenic
1090870730 11:130744878-130744900 CTATAAATTCACTGGGCGTTGGG + Intergenic
1091348789 11:134875939-134875961 CTATAAATACAGTTAACATTTGG + Intergenic
1092859140 12:12704676-12704698 TTATAAATACAGTTGTGGTTTGG + Intergenic
1092961399 12:13599758-13599780 CTGTAAATAGATTTGAAATTTGG + Intronic
1095820428 12:46472534-46472556 AAAAAAATACATTTGAAGTTTGG + Intergenic
1097139179 12:56885554-56885576 CTATAAATATACCTGAAGTAGGG + Intergenic
1097415808 12:59315578-59315600 CTACGAATACAATTGAATTTTGG + Intergenic
1098149612 12:67533050-67533072 TTATAACTCTACTTGAAGTTTGG + Intergenic
1098835573 12:75420695-75420717 CAATAATTCCAATTGAAGTTGGG + Intronic
1103514916 12:121501156-121501178 TTATAAAGACACTTGACATTGGG - Intronic
1104099688 12:125595276-125595298 CTATGAATAGACTTGAATGTAGG + Intronic
1106623961 13:31399892-31399914 CTATAAATGCTGTTGAATTTGGG + Intergenic
1106732816 13:32559526-32559548 ATAGAAATACACTTGAGGCTGGG + Intergenic
1107054087 13:36084457-36084479 ATATAAACAAATTTGAAGTTTGG + Intronic
1107422718 13:40263989-40264011 CTATGAATATAGTTGTAGTTTGG - Intergenic
1107483852 13:40807784-40807806 CTATAAATAATCTTGAAATAAGG + Intronic
1107891039 13:44914776-44914798 CTATAAATACACTTGTTGAGGGG + Intergenic
1108712629 13:53048816-53048838 CCTCAAATATACTTGAAGTTGGG + Intronic
1110221257 13:73076521-73076543 CCATGAATACACTTACAGTTAGG + Exonic
1110360753 13:74622222-74622244 GTATAAATACATTAGAAGCTAGG + Intergenic
1111100816 13:83583741-83583763 CTATTAATAAAATTGAATTTGGG - Intergenic
1115316363 14:32028955-32028977 CTAGAAATAAACTGGAATTTGGG + Intergenic
1115718448 14:36132163-36132185 TAATAAATATAATTGAAGTTTGG - Intergenic
1115904266 14:38189537-38189559 AAATAAATACCCTTGAAGATTGG - Intergenic
1116115859 14:40649800-40649822 TTATATATAAAATTGAAGTTCGG + Intergenic
1116147298 14:41090583-41090605 CAATATATCCACTTGAAATTAGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118905463 14:70020325-70020347 CTATTAATGTACTTGGAGTTTGG + Intronic
1120099675 14:80430266-80430288 CTATAAGCAAAATTGAAGTTAGG + Intergenic
1121052329 14:90827689-90827711 CTGAAAAAACTCTTGAAGTTAGG + Intergenic
1121378465 14:93436585-93436607 CAATAAATAAGCTTTAAGTTGGG + Intronic
1125442850 15:39722048-39722070 CTGCAAATACAGTTGAACTTGGG - Intronic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134740517 16:16539333-16539355 TTGTAAATACAATTAAAGTTGGG - Intergenic
1138851901 16:60639702-60639724 CAATAAAAATACTTGAATTTGGG + Intergenic
1140642675 16:76994678-76994700 CTTAACATAGACTTGAAGTTAGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1144932176 17:18868587-18868609 CTATAAATAAACTGTAAATTAGG + Intronic
1147510126 17:41060922-41060944 CTAGAAATAAAATTGAAATTGGG + Intergenic
1149122192 17:53183068-53183090 ATATATATGCACCTGAAGTTTGG - Intergenic
1149631047 17:58123855-58123877 TTATAAAGAAACTTGAAGTGAGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156825292 18:41423876-41423898 CTAGAAATGTACTTGAAATTAGG + Intergenic
1158652771 18:59302320-59302342 CTATAACTGCACTTGTATTTGGG - Intronic
1159622827 18:70658245-70658267 CTATACATACACTAGTAGTTGGG - Intergenic
1159723605 18:71924785-71924807 ATATAAATGCAATTGAATTTTGG - Intergenic
1160161706 18:76478062-76478084 TTACAAAAACACTTTAAGTTAGG - Intronic
1167770549 19:51512883-51512905 CAATAAATACAATTAAATTTGGG - Intergenic
927237766 2:20891013-20891035 GTAGAAATACACTTGATTTTTGG + Intergenic
928628360 2:33164401-33164423 CTATGAATAAATCTGAAGTTTGG + Intronic
928776857 2:34775977-34775999 GCATAAATACACATGAACTTTGG + Intergenic
930991349 2:57659651-57659673 CTGTAAATACACTGCATGTTGGG + Intergenic
931082795 2:58794424-58794446 TTAGAAAAACACTTGAAGATAGG - Intergenic
931617771 2:64177977-64177999 CTGCAAATACACTTGAAAATGGG + Intergenic
932291223 2:70581662-70581684 CTAAAGATACACATAAAGTTAGG - Intergenic
933468287 2:82685298-82685320 GAATAATTACATTTGAAGTTTGG - Intergenic
935313626 2:101809506-101809528 ATATAAATAAAACTGAAGTTAGG + Intronic
938912143 2:135895985-135896007 GTATAAATACATTTTACGTTTGG + Intergenic
939209572 2:139156483-139156505 CTCTAAAGACATTTTAAGTTAGG - Intergenic
940063074 2:149594404-149594426 CTAAAAGCACATTTGAAGTTTGG + Intergenic
940399632 2:153233068-153233090 CTACAAATACACTTTTTGTTTGG + Intergenic
941166471 2:162088362-162088384 CAATAAATACATGGGAAGTTGGG + Intergenic
941256714 2:163241291-163241313 CTCTACATCCACTGGAAGTTGGG + Intergenic
942628410 2:177928898-177928920 CTATACATAATCTTGAAGTTAGG + Intronic
943055770 2:182976941-182976963 CTATTACTACAGTTGAAGATGGG - Exonic
943693413 2:190893878-190893900 CTAAAAATGCATTTGAAGCTGGG - Intronic
944995889 2:205292952-205292974 TTATAAATACACTTTAAGCAAGG - Intronic
945819270 2:214643670-214643692 TTATAAATATACTTAAAATTAGG - Intergenic
946887498 2:224237620-224237642 CTATAAATATCCTTGAGCTTTGG + Intergenic
946962098 2:224996317-224996339 CTACAAGTCCCCTTGAAGTTTGG - Intronic
947979764 2:234398923-234398945 TAGTAATTACACTTGAAGTTGGG - Intergenic
1169516833 20:6325918-6325940 CTATAAATGCACATGACTTTTGG - Intergenic
1169682859 20:8236022-8236044 CTACAAATTCAGTTAAAGTTAGG + Intronic
1173471554 20:43327178-43327200 ATATATATATACTTTAAGTTCGG + Intergenic
1174551910 20:51368299-51368321 CTTTAAAGACACTTGTTGTTAGG + Intergenic
1176702801 21:10077500-10077522 CCATTGATACACTGGAAGTTTGG + Intergenic
1177767236 21:25472937-25472959 CTATGAAGACACTTGAACATGGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
949803734 3:7932185-7932207 TTTTATATACACTGGAAGTTAGG + Intergenic
949960916 3:9311569-9311591 CCATAAATACAGTTGTATTTGGG - Intronic
950302313 3:11891326-11891348 TTATAAATACACTGTAATTTAGG + Intergenic
954375093 3:50189926-50189948 CTATATGTACACTTGAATTTGGG - Intergenic
954976538 3:54700451-54700473 TTATTAAAACACTTGAAATTTGG - Intronic
956441458 3:69284581-69284603 CTATAAATATTCTTGATGTTTGG - Intronic
957558880 3:81796225-81796247 CTATAAAAACACTAAAATTTGGG + Intergenic
957576200 3:82011211-82011233 TTACAAATAAAATTGAAGTTAGG - Intergenic
958560610 3:95743777-95743799 CTATAAAGATACCTGAAATTTGG - Intergenic
959245418 3:103861994-103862016 CTATAAAGATACTTGAAAATGGG + Intergenic
959388484 3:105743099-105743121 CCAAAAATTCACTTGAGGTTGGG - Intronic
963702180 3:148640223-148640245 CAATCAATACAATTGCAGTTTGG - Intergenic
965170607 3:165258653-165258675 CTATAAAAACACTTGAGGCCGGG - Intergenic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
967126114 3:186426236-186426258 CTGAAAATACACTTGTGGTTTGG - Intergenic
969179785 4:5430327-5430349 TTATCAATAGACTTGAAGATAGG - Intronic
970818840 4:20189916-20189938 CTATAAAGACACCTGAAAATGGG + Intergenic
971018781 4:22514503-22514525 CTATGAAAACACTTAAAGTATGG - Intronic
971060257 4:22960094-22960116 CCATCAATACAGTTCAAGTTTGG - Intergenic
971857099 4:32058090-32058112 GTATAAAAACACTTGATGTCAGG - Intergenic
972672863 4:41230587-41230609 TTAGAAATATACTTGAAATTAGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974503463 4:62735732-62735754 TAATAACTACACTTGAAGGTGGG + Intergenic
978591460 4:110329049-110329071 CTATAAAGATACTTGAAATGTGG + Intergenic
980042330 4:127953644-127953666 CTAAAAATACACTTGAACCCAGG - Intronic
980648019 4:135670485-135670507 CTCCAAATACACTGGAAGTTAGG + Intergenic
980725022 4:136747361-136747383 TAAAAAATACACTGGAAGTTTGG - Intergenic
980948253 4:139345608-139345630 TTTTAAATAGACTTGATGTTTGG - Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983610703 4:169641879-169641901 CTATAAATACATTTGTATTATGG - Intronic
986875483 5:12102724-12102746 CTATCATTACATTTGAGGTTAGG - Intergenic
987422829 5:17740708-17740730 CTTGAAAAATACTTGAAGTTTGG + Intergenic
987563085 5:19549449-19549471 CTATAAAAATACCTGAAGCTGGG - Intronic
988192210 5:27953132-27953154 CTATAAATAAAAATGAACTTTGG - Intergenic
989157938 5:38362152-38362174 CAATAAATAAACTTTCAGTTGGG - Intronic
992165406 5:74045384-74045406 CTATATATATATTTTAAGTTAGG + Intergenic
992965345 5:81993815-81993837 CTATAAATGAAGTTGTAGTTTGG + Intronic
993110232 5:83647981-83648003 AGATAAATACAATGGAAGTTTGG + Intronic
994246338 5:97482646-97482668 TTTTAAATACACTTGAATGTAGG - Intergenic
994319668 5:98378464-98378486 GTATGTATACAGTTGAAGTTTGG + Intergenic
994513587 5:100741071-100741093 CTATAGTAAGACTTGAAGTTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995211344 5:109543021-109543043 CCATAAAAACCCTTGAAGGTAGG + Intergenic
995283410 5:110359793-110359815 CTTTAAATTCACTTTAAGTAAGG - Intronic
996957218 5:129198129-129198151 CTATACAAACACTTGAAGTTTGG + Intergenic
997203737 5:132028645-132028667 CTATAATTACATTTGAAGAGGGG + Intergenic
997388370 5:133493376-133493398 CTAGAAATAAACTTAAAGATAGG - Intronic
1000966203 5:167659957-167659979 CTGTAAATACACCTGAAATAAGG + Intronic
1002039321 5:176500569-176500591 ATATAAGTGCACTTGCAGTTTGG + Intronic
1002152757 5:177249171-177249193 GTATATACAAACTTGAAGTTAGG + Intronic
1003383497 6:5646566-5646588 CTATAACTACAGTTGGACTTTGG + Intronic
1008634018 6:53391309-53391331 CTATAAAGACACTTTCAGTTAGG + Intergenic
1008821966 6:55643654-55643676 AAATAAAAACACTTGAATTTTGG - Intergenic
1009485174 6:64212456-64212478 TTAAAAATACACTTGTATTTTGG + Intronic
1011336191 6:86262630-86262652 ATATAGATACACTTAAATTTTGG - Intergenic
1011852831 6:91652009-91652031 CTATCACTACAGTGGAAGTTAGG + Intergenic
1013106874 6:107033191-107033213 CTATCACTACACTTAGAGTTTGG + Intronic
1013445189 6:110218665-110218687 ATATAAATACCTTTGAAGGTAGG - Intronic
1014264937 6:119266313-119266335 CTATAGAAAGTCTTGAAGTTGGG - Intronic
1016246053 6:141982373-141982395 CCATAAATTTACTTGAGGTTGGG - Intergenic
1019853277 7:3580666-3580688 CTATAAAAACTCTGGAAGATGGG + Intronic
1020427239 7:8081974-8081996 CTAGAAATACAGTTGAGATTAGG - Intronic
1020670654 7:11105132-11105154 TTATAAAAAGACTTGAAATTAGG + Intronic
1021069991 7:16225264-16225286 CTTAAAATACTTTTGAAGTTAGG - Intronic
1024736252 7:52307955-52307977 CTATAAATAAACTGTAATTTAGG + Intergenic
1027878631 7:83803015-83803037 CTATAAATTCAGATAAAGTTTGG + Intergenic
1027925508 7:84457043-84457065 ATATAAATATACTTGCATTTTGG + Intronic
1030202059 7:106915695-106915717 CTTTGAATAAACTAGAAGTTAGG - Intergenic
1032674850 7:134120247-134120269 CTACAAATACACTTGCATTGTGG + Intergenic
1032844927 7:135744350-135744372 TTAAAAATACAGTTGGAGTTTGG - Intronic
1034129869 7:148705773-148705795 CTATAGATAAGCTTGAAGTTTGG - Intronic
1035484980 7:159215991-159216013 TTATAAATAAACATGCAGTTAGG + Intergenic
1037470268 8:19201748-19201770 CTATAAAAACACCTAAAGCTGGG - Intergenic
1038830820 8:31057801-31057823 CTTTAATTATACTTGAATTTTGG + Intronic
1040677328 8:49766117-49766139 CTATAAAGATACATGAAGATGGG + Intergenic
1041373240 8:57186598-57186620 CTATAAAATCACTTGAAGCCAGG - Intergenic
1042035383 8:64527177-64527199 GTATAAAAACACTTGTAGTATGG - Intergenic
1043085450 8:75826425-75826447 CTATAAAAATACTTGAAATGTGG + Intergenic
1045067118 8:98458976-98458998 CTATAAAGATACTTGAAATGTGG + Intronic
1045638514 8:104221752-104221774 TTTTAAATACACTTAAAATTAGG - Intronic
1045875032 8:106970830-106970852 CTAAATATACACTTGTAATTTGG - Intergenic
1046303647 8:112332636-112332658 TTTAAAATAAACTTGAAGTTTGG - Intronic
1047855023 8:128900101-128900123 CTATAGATAAATTTGAAATTAGG - Intergenic
1048337073 8:133510714-133510736 TTGTAAATCCACTTGAAATTGGG - Intronic
1050667115 9:7951832-7951854 CTTAAAATACACTTGAAGTTTGG - Intergenic
1051648714 9:19297834-19297856 ATATAAATAGACTTTAAGTCAGG + Intronic
1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG + Intergenic
1053640057 9:40064540-40064562 CCATTGATACACTGGAAGTTGGG + Intergenic
1053766076 9:41400942-41400964 CCATTGATACACTGGAAGTTTGG - Intergenic
1054320753 9:63660538-63660560 CCATTGATACACTGGAAGTTTGG + Intergenic
1054544690 9:66312095-66312117 CCATTGATACACTGGAAGTTGGG - Intergenic
1054992898 9:71350905-71350927 CTATAAATACCCTGGCAATTAGG + Intronic
1056520916 9:87400743-87400765 CTATAAATTCTCTTGATATTTGG + Intergenic
1057832430 9:98417526-98417548 TTATGAATACACATGGAGTTGGG - Intronic
1058657377 9:107235892-107235914 CTATTATTTCATTTGAAGTTGGG - Intergenic
1058987652 9:110223570-110223592 CTATAAATGCTTTTGAAATTTGG - Intergenic
1060833430 9:126734974-126734996 GAATCAATACACTTGAAGATAGG + Intergenic
1061354747 9:130096041-130096063 TTCTACCTACACTTGAAGTTGGG - Intronic
1202787823 9_KI270719v1_random:47608-47630 CCATTGATACACTGGAAGTTTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186612574 X:11152668-11152690 CCATGAATCCACTTGGAGTTTGG - Intronic
1188175752 X:26986593-26986615 CTATGACTCTACTTGAAGTTAGG + Intergenic
1188667900 X:32847044-32847066 CTATATATACACAAGAAGATTGG - Intronic
1190411776 X:50143700-50143722 CTATAAAAACACATTGAGTTTGG + Intergenic
1192838456 X:74827733-74827755 CTAAACATGAACTTGAAGTTGGG + Intronic
1195030048 X:100918134-100918156 CTATTAAAACACTTGATGTAGGG + Intronic
1195879063 X:109573864-109573886 TTATAAATACACCTGAAAATGGG + Intergenic
1196232863 X:113244672-113244694 CAATACATAAACTTGAAATTTGG - Intergenic
1197479539 X:126965728-126965750 CTATAAAAATACTTAAGGTTGGG + Intergenic
1198385995 X:136130221-136130243 GCATAAATACACTGGAAGTTGGG + Intergenic
1199029345 X:142978371-142978393 CTATATATAGAATTGAAATTAGG - Intergenic
1199772937 X:150985483-150985505 CTAAAACTACACTTGCTGTTAGG - Intronic
1200244989 X:154518266-154518288 GTATACATACACTTAAAGCTGGG + Intergenic
1201958133 Y:19648452-19648474 CTTCAAATGCACTTGAACTTTGG + Intergenic