ID: 913563396

View in Genome Browser
Species Human (GRCh38)
Location 1:120046379-120046401
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 4, 1: 1, 2: 0, 3: 7, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913563396 Original CRISPR AGTGCGAAGTGATTGGCCCT TGG (reversed) Intronic
901320681 1:8338261-8338283 AGGGCGAAGTGGGGGGCCCTGGG + Intronic
901320784 1:8338679-8338701 AGTGCGGTTTGATTGGCGCTTGG - Intronic
901938679 1:12645387-12645409 AGAGCCCAGTGATTGGCACTCGG - Intronic
902288114 1:15419591-15419613 AGTGGGCAGTGACTGGCCCAGGG - Intronic
902336061 1:15755699-15755721 AGAGAGAAGTGATTTGCCCAAGG + Intergenic
906394383 1:45448695-45448717 AGTGGGAAGTGATTGGATCATGG - Intronic
909097336 1:71304148-71304170 GGTGGGAAGTGATTGGATCTGGG - Intergenic
910147549 1:84100265-84100287 AGTGGGAAGTGATTGGATCATGG - Intronic
910345662 1:86233705-86233727 AGTGAGAAGTGATTGGATCATGG - Intergenic
911693337 1:100860406-100860428 GGTGGGAGGTGATTGGCTCTTGG - Intergenic
913040061 1:115013120-115013142 AGTGGGAAGTAATTGGATCTTGG + Intergenic
913563396 1:120046379-120046401 AGTGCGAAGTGATTGGCCCTTGG - Intronic
913634727 1:120747198-120747220 AGTGTGAAGTGATTGGCCCTTGG + Intergenic
914283990 1:146205743-146205765 AGTGCGAAGTGATTGGCCCTTGG - Intronic
914384638 1:147156471-147156493 AGAGCAAAGTGAGTGGGCCTGGG + Exonic
914545021 1:148656482-148656504 AGTGCGAAGTGATTGGCCCTTGG - Intronic
914621546 1:149414206-149414228 AGTGCGAAGTGATTGGCCCTTGG + Intergenic
916312341 1:163410951-163410973 AGTGAGAACTGCTAGGCCCTTGG - Intergenic
916482148 1:165224031-165224053 AGTGGGAAGTGATTGGATCATGG + Intronic
917355855 1:174125450-174125472 GGTGGGAGGTGATTGGCCCATGG + Intergenic
917959026 1:180127966-180127988 AGTGGGAAGTCCTAGGCCCTGGG - Intergenic
918626379 1:186660434-186660456 GGTGGGAGGTGATTGGACCTTGG - Intergenic
920785183 1:209034347-209034369 AGTGGGAAGTGATTGGATCATGG - Intergenic
922844548 1:228673514-228673536 GGTGGGAAGTGATTGGCTCATGG + Intergenic
923621231 1:235581161-235581183 GGTGGGAAGTGATTGGACATGGG + Intronic
1066695742 10:38076231-38076253 TGTGGGAAGTGATTGGCTCAGGG - Intergenic
1069981080 10:72252997-72253019 GGTGGGAAGTGATTTGCCCAGGG - Intergenic
1074717200 10:116230413-116230435 AGTGAGAAGAGCTTGGCCTTTGG - Intronic
1076377504 10:130001436-130001458 AGTGGGAGCTGATTGGACCTTGG + Intergenic
1076789891 10:132771336-132771358 AGTGCTGAGGGATTGACCCTGGG + Intronic
1077321947 11:1946701-1946723 AGGGCGAGGTGAGGGGCCCTGGG + Intergenic
1079294288 11:19218552-19218574 ACTGGGAAGTGGATGGCCCTTGG + Intergenic
1079872776 11:25821266-25821288 AGTGGGAAGTGACTGGACCATGG + Intergenic
1082935614 11:58653704-58653726 AGTGGGAAGTGATTGGACTATGG + Intronic
1083916092 11:65744563-65744585 AGTGCGTGCTGATTGGCCCATGG - Intergenic
1086147949 11:83574840-83574862 AGTGCCAAGTGGTTGTGCCTAGG - Intronic
1088328112 11:108622571-108622593 AGTGGGAAGTGATTGGATCATGG - Intergenic
1089278506 11:117355919-117355941 AGTGAGAAGAGACAGGCCCTAGG + Intronic
1090185892 11:124738966-124738988 AATTCGAAGTAATTGGCTCTTGG - Intergenic
1090625965 11:128609175-128609197 AGTTAGAAGTGATTGGTCTTCGG + Intergenic
1090910781 11:131117568-131117590 AATGCAAAGTGATTTGCCCAAGG + Intergenic
1091341820 11:134821873-134821895 AGAGTGAAGAGACTGGCCCTGGG - Intergenic
1202804963 11_KI270721v1_random:2014-2036 AGGGCGAGGTGAGGGGCCCTGGG + Intergenic
1091644659 12:2264506-2264528 AGGGTTAAGTGATTTGCCCTAGG - Intronic
1096832073 12:54322598-54322620 AGTGCGCAGTGATTGTGCCTGGG - Intronic
1102227810 12:111241287-111241309 AGTGAGAAGTGTTTGGGCCGTGG - Intronic
1104742541 12:131188929-131188951 AGTGCGTACTGATTGGTCCATGG - Intergenic
1104780514 12:131416913-131416935 AGTGGGAAGTGATTGGATCATGG + Intergenic
1105711664 13:23015537-23015559 AGTGAGAGGTGATTGGATCTTGG - Intergenic
1108007377 13:45963376-45963398 AGTGCTCAGTGGTTTGCCCTTGG - Exonic
1108953978 13:56127212-56127234 AGTGCGAGGTGATTGGATCATGG - Intergenic
1109488250 13:63057092-63057114 AGTGGGAGGTGATTGGACCATGG + Intergenic
1111270720 13:85880595-85880617 AGTGGGAAGTGATTGGATCATGG + Intergenic
1111655727 13:91149926-91149948 AGTGGGAGGTGATTGGCTCATGG + Intergenic
1113149771 13:107250779-107250801 AGTGGGAAGTGATTGGATCATGG + Intronic
1114244661 14:20901454-20901476 GGTGGGAAGTGATTGGATCTTGG - Intergenic
1114247660 14:20929597-20929619 GGTGGGAAGTGATTGGATCTTGG - Intergenic
1121758972 14:96427497-96427519 TGTGGGAAGTGATTGGCTCATGG - Intronic
1125157877 15:36609744-36609766 AGTGCTAAGAGCATGGCCCTGGG + Intronic
1125993824 15:44136645-44136667 AATGCAAAGTGATTGGCCTAAGG - Intronic
1132944407 16:2524676-2524698 AGTTGAAAGTGATTGTCCCTAGG - Intronic
1133770271 16:8863670-8863692 ACTGGGGAGTGAGTGGCCCTTGG - Intronic
1134591520 16:15458029-15458051 AGTGGGAAGTGATTGGATCATGG - Intronic
1135574213 16:23572674-23572696 AGTGAGAAGCAGTTGGCCCTTGG - Exonic
1137272927 16:46914656-46914678 AATGCTAAGTGAATGGGCCTGGG - Intronic
1137588635 16:49679862-49679884 AGTGCGTACTGATTGATCCTTGG - Intronic
1139014840 16:62677570-62677592 AGTGCTAATTGATTGGCTCAGGG - Intergenic
1141017186 16:80461542-80461564 GGTGGGAAGTGATTGGCTCGTGG + Intergenic
1142709694 17:1716287-1716309 AGTGGGCGGTGATTGGCCCCGGG - Intergenic
1142857932 17:2742982-2743004 AGTGAGAAGTGACTGGCTTTGGG - Intergenic
1143455842 17:7067212-7067234 AGTGGGAAGTGATTGGGTCATGG - Intergenic
1144221178 17:13101220-13101242 AGTGAGAAGTGATTGGGTCATGG + Intergenic
1145171719 17:20663518-20663540 AGTGAGAGGTGATTGGCTCATGG - Intergenic
1148431213 17:47645298-47645320 TGTGCTAAGTGAGTGGTCCTTGG - Intergenic
1148734984 17:49860332-49860354 AGAGGGCAGTGAATGGCCCTGGG + Intergenic
1149184201 17:53978206-53978228 GGTGGGAGGTGATTGGACCTTGG - Intergenic
1149510125 17:57234065-57234087 AGTGGGAAGTGATTGGATCATGG - Intergenic
1153080448 18:1217622-1217644 CGTGGGAAGTGATTGTCCTTTGG + Intergenic
1153519371 18:5937631-5937653 AGTGGGAAGTGATTAACCCTGGG + Intergenic
1156607395 18:38681762-38681784 AGTGGGAAGTGATTGGCTAATGG - Intergenic
1158861670 18:61598500-61598522 AGTGGGAAGTGTTTGGATCTGGG + Intergenic
1159703794 18:71661941-71661963 GGTGGGAAGTGATTGGATCTTGG + Intergenic
1159931851 18:74320386-74320408 GGTGGGAAGTGATTGGCTCATGG - Intronic
1162722826 19:12672685-12672707 AGTAGGACGTAATTGGCCCTGGG + Intronic
1165650375 19:37482708-37482730 GGTGGGAAGTGATTGGATCTTGG + Intronic
927246503 2:20960901-20960923 GGTGCGAGGTGATTGGGCCATGG + Intergenic
928408997 2:31039540-31039562 AGTGAGAACTGATTGGCCACTGG - Intronic
929121859 2:38490123-38490145 AGTGCCAACTGCCTGGCCCTTGG + Intergenic
932177995 2:69620151-69620173 AGTAAGAAGTGGTTGGACCTTGG + Intronic
932468522 2:71939238-71939260 CTTGCCAAGAGATTGGCCCTGGG + Intergenic
933624710 2:84585838-84585860 AGTGTGTACTGATTGGCCCATGG + Intronic
934915645 2:98299083-98299105 AGTTTGCAGTGATTGGCCTTAGG + Intronic
936116031 2:109703987-109704009 TGTGAGAAGTGATTGGCAGTGGG - Intergenic
937984349 2:127631885-127631907 AGTGGGAAGGGTTGGGCCCTTGG + Intronic
939464385 2:142538720-142538742 GGTGCCCAGTGCTTGGCCCTTGG - Intergenic
944338442 2:198565818-198565840 AGTGGGAGGTGATTGGATCTTGG + Intronic
945712692 2:213318686-213318708 AATGGTAAGTGGTTGGCCCTGGG - Intronic
946584732 2:221172327-221172349 AGTGGGAAATGATTTGCCCAAGG - Intergenic
947334652 2:229068875-229068897 AGTGGTCAGTGATTGGTCCTGGG - Intronic
1169883292 20:10370376-10370398 AGTGCGGAATGAATGGACCTGGG + Intergenic
1172751040 20:37251453-37251475 AAGGCGAAGTGACTGGCCCAGGG - Intronic
1172897694 20:38312124-38312146 TGTGGGAAGTGATTGTCTCTTGG - Intronic
1175150707 20:56931726-56931748 AGAGTGAAGTCATTGGCCCAAGG - Intergenic
1177974459 21:27829701-27829723 AGTGCAAAGTGATTGGATCATGG - Intergenic
1178618707 21:34155840-34155862 TTTGCGAAGTCATTGTCCCTGGG + Intergenic
949280765 3:2344084-2344106 AGTGCGAGGTGTTTGGGCCATGG - Intronic
951264697 3:20552398-20552420 AGTGCGTACTGATTGGTCCATGG + Intergenic
953127504 3:40105868-40105890 AGTGGGAAGTGATTGGATCATGG - Intronic
954908001 3:54079216-54079238 AGGGAGAAGTGATAGCCCCTTGG + Intergenic
956989480 3:74746915-74746937 AGTGGGAAGTGATTGGATCATGG - Intergenic
958604641 3:96341114-96341136 AGTGGGAAGTGATTGGATCATGG + Intergenic
958942580 3:100332190-100332212 AGGGTGAGGTGATTTGCCCTAGG + Intergenic
959449872 3:106485951-106485973 AGTGATTATTGATTGGCCCTGGG - Intergenic
960077944 3:113509782-113509804 AGTGGGAAGTGATTGGATCATGG + Intronic
963296965 3:143557082-143557104 AGTGGGAAGTGATTGGAGCATGG + Intronic
964271103 3:154957822-154957844 GGTGGGAAGTGATTGGCTCATGG - Intergenic
966183913 3:177211372-177211394 AGTGGGAGGTGCTTGGCTCTTGG + Intergenic
969390857 4:6890386-6890408 GGTGGGAGGTGATTGGGCCTTGG + Intergenic
969483023 4:7456875-7456897 ATTTAGAAGTGGTTGGCCCTGGG + Intronic
971103816 4:23499256-23499278 AGTGCGAGGTGATTGGATCATGG + Intergenic
971941772 4:33224697-33224719 AGTGGGAGGTGATTGGATCTTGG + Intergenic
974014828 4:56639348-56639370 GGTGGGAAGTGATTGGACCATGG + Intergenic
976365625 4:84229741-84229763 ACTGGGAAGTGATTGGCTCATGG - Intergenic
979514113 4:121587345-121587367 ACTGCTCAGTGATTGTCCCTAGG + Intergenic
980874962 4:138652293-138652315 AGTGGGAAGTGATTGGATCATGG + Intergenic
981275282 4:142892402-142892424 AGTGGGAAGTGATTGGGTCACGG + Intergenic
981450802 4:144895509-144895531 TGTGCCTAGTGATTAGCCCTTGG + Intergenic
982038734 4:151373597-151373619 AGTGGGAAGTGTTTGGGTCTTGG - Intergenic
983784585 4:171715618-171715640 AGTGTGCACTGATTGGTCCTTGG - Intergenic
983797155 4:171878775-171878797 AGTGGGAGGTGATTGGATCTTGG + Intronic
986250509 5:6053538-6053560 AGTGGGAGGTGATTGGGTCTTGG + Intergenic
986482562 5:8203552-8203574 GGTGGGAAGTGATTGGCTCATGG - Intergenic
987598619 5:20035637-20035659 AGTGGGAGGTGATTGGACCATGG - Intronic
988606857 5:32686029-32686051 AGTGGGAAGTGTTTGGACTTGGG + Intergenic
994797205 5:104318747-104318769 AGTGGGAAGTGATTGACTCATGG + Intergenic
996498768 5:124192610-124192632 AGTGGGAGGTGATTGGATCTTGG - Intergenic
998142359 5:139707352-139707374 AGAGCAAAGTGCCTGGCCCTGGG + Intergenic
999389294 5:151178544-151178566 AAAGGGAAGTGATTTGCCCTAGG - Intergenic
1003509133 6:6764815-6764837 AGTGGGAAGTGTTTGGGTCTTGG + Intergenic
1003781214 6:9429260-9429282 AGTGGGAAGTAATTGGATCTTGG - Intergenic
1005843082 6:29757354-29757376 AGTGAGAAGTGATTGGATTTGGG - Intergenic
1005872189 6:29982912-29982934 AGTGTGAAGTGATTGGTTTTGGG - Intergenic
1006057231 6:31394232-31394254 AGTGAGAAGTGATTGGATTTGGG + Intergenic
1007581934 6:42965032-42965054 ACTGCGAAGGGCTTGGGCCTTGG - Intronic
1009554911 6:65150065-65150087 AGTGTGAAGTGATTGGATCATGG - Intronic
1010458060 6:76082097-76082119 AGTGGGAAGTGATTGGATCTTGG - Intergenic
1010962631 6:82163934-82163956 AGTGCAAGTTGATTGGCTCTGGG - Intergenic
1011169875 6:84493458-84493480 TGTTCGAGGTGGTTGGCCCTTGG - Intergenic
1011242083 6:85283223-85283245 AGTGGGAAGTGATTGGATCATGG - Intergenic
1013350276 6:109299388-109299410 AGTGGAAAGTGATGAGCCCTTGG - Intergenic
1017812862 6:157996644-157996666 AGTGGGAGGTGATTGGGCCATGG + Intronic
1027604381 7:80282957-80282979 AGTGGGAAGTGATTGGATCTTGG + Intergenic
1028680826 7:93529163-93529185 AGTGGGAGGTGATTGGACCATGG + Intronic
1028831967 7:95338103-95338125 AGTGGGAGGTGATTGGCTCATGG - Intergenic
1029442074 7:100592499-100592521 AGTGGGAGGTGATTGGCTCACGG - Intronic
1030267755 7:107637900-107637922 AGTGGGAAGTGATTGGATCATGG - Intergenic
1031455824 7:121978596-121978618 AGTGGGAAGTGATTGGATCATGG - Intronic
1034919051 7:155064277-155064299 AGTGGGAAGTGATTGGATCATGG + Intergenic
1036613498 8:10370648-10370670 AGAGCAAAGTGGTTGGCCCGAGG - Intronic
1037212921 8:16414027-16414049 GGTGCGAAGTGATTGGATCATGG + Intronic
1038308477 8:26425921-26425943 AGGGAGGAGTGATTGGACCTGGG - Intronic
1038699376 8:29835594-29835616 AGAGTGAGGTGATGGGCCCTGGG - Intergenic
1040799077 8:51321514-51321536 AGTGGGAGGTGATTGGATCTTGG + Intronic
1041357264 8:57014116-57014138 AGTGCACACTGATTGGCCCATGG + Intergenic
1042058134 8:64788009-64788031 AGTGGGAAGTGATTGGATCTTGG - Intronic
1042583738 8:70311728-70311750 AATGTTAAGTGATTGGCCTTGGG - Intronic
1046068909 8:109226802-109226824 AGTGGGAAGTGTTTGGGCCATGG + Intergenic
1047078907 8:121437346-121437368 AGTGCCAAGTGATTGATGCTGGG - Intergenic
1047960710 8:130009820-130009842 AGTGGGATGTGATTTGCCCAAGG + Intronic
1048889505 8:138935057-138935079 TGTGAGATGTGATTGGCCTTGGG - Intergenic
1049140504 8:140949917-140949939 AGTGCGTACTGATTGGGCCATGG - Intronic
1051107158 9:13593305-13593327 AGTGGGAGGTGATTGGCTCATGG + Intergenic
1055369264 9:75579595-75579617 AGTGGGAAGTGATTGGATCACGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1056575346 9:87852082-87852104 AGTGGGAAGTGATTGTTCCTTGG - Intergenic
1058444014 9:105037975-105037997 AGTGAAAAGTGATTGCCTCTGGG - Intergenic
1058740098 9:107934338-107934360 AGTGGGATGTGATTGGATCTTGG + Intergenic
1059503471 9:114776917-114776939 AGTGGGAAGTGATTGGATCATGG - Intergenic
1059786644 9:117593498-117593520 GGTGGGAAGTGATTGGCTCACGG + Intergenic
1185799421 X:2996226-2996248 AGTGTGAAGTGATGGGATCTTGG - Intergenic
1186373489 X:8970846-8970868 GGTGGGAAGTGATTGGATCTTGG + Intergenic
1186562448 X:10627005-10627027 AGTTGAAAGTGATTGTCCCTAGG + Intronic
1187692530 X:21883897-21883919 AGTGTGAAGCTATTGGTCCTAGG + Exonic
1188259856 X:28009426-28009448 AGTGGGAGGTGATTGGATCTTGG - Intergenic
1188744072 X:33820295-33820317 AGTGGGAAGTGTTTGGGTCTTGG + Intergenic
1189911469 X:45814585-45814607 GGTGGGAAGTGATTGGATCTTGG - Intergenic
1192369797 X:70503914-70503936 ACAGAGAAGTGCTTGGCCCTAGG + Exonic
1194309567 X:92287825-92287847 GGTGGGAAGTGATTGGCTCATGG + Intronic
1194328786 X:92556092-92556114 AGTGGGAAGTAATTGGCTCATGG - Intronic
1194853057 X:98892466-98892488 AGTGGGAAGTGTTTGGCTCATGG + Intergenic
1196993387 X:121353613-121353635 AGTGGGAAGTGATTGGATCATGG + Intergenic
1198171091 X:134105806-134105828 AGTGGGAGGTGATTGGACCATGG + Intergenic
1198658826 X:138944195-138944217 AAAGCAAAGTGATTGGCCCAAGG - Intronic
1199243275 X:145573640-145573662 AGTGGGAAGTGTTTGGGACTTGG + Intergenic
1199360358 X:146910539-146910561 AGTTGGAAGTGATTGGATCTTGG - Intergenic
1199384437 X:147207573-147207595 AGTGGGAAGTGATTGGATCATGG + Intergenic
1200295528 X:154915204-154915226 AGTGGGAAGTGATTGGGTCATGG - Intronic
1200617860 Y:5402087-5402109 GGTGGGAAGTGATTGGCTCATGG + Intronic
1201935401 Y:19406536-19406558 AGTGTGTGGTGATTGGCCCATGG + Intergenic