ID: 913564913

View in Genome Browser
Species Human (GRCh38)
Location 1:120063449-120063471
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 5, 1: 0, 2: 0, 3: 6, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913564909_913564913 13 Left 913564909 1:120063413-120063435 CCAAAAAGGCTGTGGAACTCCTA No data
Right 913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG 0: 5
1: 0
2: 0
3: 6
4: 141
913564910_913564913 -6 Left 913564910 1:120063432-120063454 CCTATGCATTCTAACATCTCAGG 0: 5
1: 0
2: 0
3: 16
4: 125
Right 913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG 0: 5
1: 0
2: 0
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG + Intergenic
904456051 1:30648849-30648871 CTCAGGGAACTTACTAAAGGCGG - Intergenic
904823342 1:33258733-33258755 CTCAGGAAAGATTATGATGGCGG - Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
910151661 1:84154911-84154933 CTCAGCTAACATCTTAATAGCGG + Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
917578381 1:176348471-176348493 CAAAGGTAACATTCTAAGGATGG + Intergenic
919659523 1:200230190-200230212 TTGAGCTAACATTCTAATGATGG - Intergenic
919688981 1:200511612-200511634 CTCATGTCACATTTTAATGTGGG - Intergenic
921121395 1:212140548-212140570 CTCATGTTACATTCTAGTGGAGG - Intergenic
922149537 1:222986387-222986409 CTCAAGTGACATTAAAATGGGGG - Intronic
922278194 1:224098830-224098852 GTCAGAGAACATTTTAATGGAGG - Intergenic
924007824 1:239631600-239631622 CTAGGTTAACCTTCTAATGGAGG + Intronic
924448395 1:244155639-244155661 TTCGGAAAACATTCTAATGGAGG - Intergenic
1065322731 10:24524269-24524291 CTCATGTCACTTTCTCATGGTGG - Intronic
1067150596 10:43729456-43729478 CTCAGGTTCTATTCTAGTGGTGG + Intergenic
1068823693 10:61409335-61409357 CTCAGGGAACATGGTGATGGAGG - Exonic
1070798073 10:79228703-79228725 CTCAGGGAACACTGAAATGGTGG - Intronic
1072749406 10:97966530-97966552 CCCATGTAACATACTAATGTAGG - Intronic
1072767217 10:98105253-98105275 CTTAAGGGACATTCTAATGGAGG - Intergenic
1073562446 10:104508299-104508321 CTCAGGCAACATTCTGATTCAGG - Intergenic
1074848992 10:117423687-117423709 TGCAGCTGACATTCTAATGGGGG + Intergenic
1078866368 11:15301856-15301878 AAGAGGTCACATTCTAATGGTGG + Intergenic
1079134977 11:17771331-17771353 CTCAGGTAACAGTTCAATGTGGG + Intronic
1084566032 11:69929600-69929622 CTCATGTCACAATCCAATGGAGG - Intergenic
1085904788 11:80747418-80747440 CTCAGGCAACCTTCTAAAAGTGG + Intergenic
1086901112 11:92368688-92368710 CTCAGGTTATATTCATATGGTGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1087885698 11:103479805-103479827 TTCAGGTGACATAATAATGGAGG + Intronic
1092522873 12:9291730-9291752 CTCAGCTCACTTTCAAATGGAGG + Intergenic
1092544415 12:9440167-9440189 CTCAGCTCACTTTCAAATGGAGG - Intergenic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1093634578 12:21449687-21449709 CTCAGGTAACATTTTAAGGTTGG + Exonic
1094227549 12:28062890-28062912 TTAAGGTAACATTCTCAGGGGGG - Intergenic
1094508535 12:31081900-31081922 CTCAGCTCACTTTCAAATGGAGG + Intronic
1098443705 12:70544921-70544943 CAGAGGTTACATTCTCATGGAGG + Intronic
1098524017 12:71465721-71465743 CTGAGGTAAGTTTCTAATAGAGG - Intronic
1098965344 12:76782287-76782309 CTCAGGTAACATTCCAGGGAGGG - Intronic
1100023265 12:90097181-90097203 CACAGGTATCCTTCTAAGGGGGG + Intergenic
1100876881 12:98971605-98971627 CTCACCTAACATTCAAATGAAGG + Intronic
1101316599 12:103634698-103634720 CTCATGTAACAGTCCAATGTGGG + Intronic
1102565817 12:113796845-113796867 CTCATGGAACATTCTAGTTGGGG + Intergenic
1109795072 13:67300370-67300392 CTCTGGTAAAATTGTGATGGAGG + Intergenic
1110639770 13:77809354-77809376 CTCAATGAACATTCTTATGGGGG - Intergenic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1113058843 13:106299252-106299274 CTGAGGTAAATTTCTAATTGTGG - Intergenic
1113086482 13:106574340-106574362 ATCAGGGAACATTCTTCTGGAGG + Intergenic
1114764396 14:25354332-25354354 CCCAAGTAACATTCTAATCTCGG - Intergenic
1118760448 14:68877836-68877858 CTGAGGTAACACACTAATGACGG + Intronic
1120771260 14:88382967-88382989 CTCAGGAAACACTATCATGGTGG - Intergenic
1121597759 14:95178856-95178878 CCCAGGTCACATTCTCTTGGGGG + Intergenic
1122136733 14:99637680-99637702 CTCAGGGAACATTCTCCTGAAGG - Intergenic
1125160350 15:36636202-36636224 GTCAGGTAACAGTCAAATTGTGG - Intronic
1127150866 15:56073870-56073892 CTCAGGTAGTTTTCTAATGATGG - Intergenic
1127278625 15:57469526-57469548 CTTAGTTAACAGTCTATTGGGGG + Intronic
1128845971 15:70894983-70895005 CTCTAGAAACATTATAATGGTGG - Intronic
1133635412 16:7660572-7660594 CCTAGGTTATATTCTAATGGAGG - Intronic
1141060999 16:80869756-80869778 CCCAGTCAACATTTTAATGGTGG + Intergenic
1142948199 17:3453529-3453551 CACAGCTAACATCATAATGGGGG + Intronic
1146624347 17:34424450-34424472 CTCAGGAAACACTGTTATGGGGG - Intergenic
1147060512 17:37873566-37873588 GACAAGTAACATTCTAATGTAGG + Intergenic
1149248214 17:54736771-54736793 CCCAGGCAACATTCTAAGGAAGG + Intergenic
1157083671 18:44555249-44555271 CTGAGTTATCATTATAATGGGGG - Intergenic
1157699943 18:49755933-49755955 CTGAGCTTACATTCAAATGGAGG - Intergenic
1159259750 18:65998382-65998404 CTCATGCCACAATCTAATGGGGG - Intergenic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG + Intronic
932755942 2:74409580-74409602 CTCAGGTAGCATCTTAATAGTGG - Intergenic
933596522 2:84288667-84288689 CTCAGGCAACATCCTGAGGGTGG - Intergenic
936889719 2:117354984-117355006 CTCAGATGACATTCTAGTGGAGG + Intergenic
937140962 2:119599791-119599813 CACAGTTTACATTCTAGTGGGGG - Intronic
945265987 2:207891925-207891947 CTCAGGTGACATTTTATTTGGGG + Intronic
945903572 2:215566045-215566067 CTAAGGTCACATTCCAAGGGAGG - Intergenic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
946867358 2:224054176-224054198 CTCAGGCAACATACTAAGGGTGG + Intergenic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
948538016 2:238661513-238661535 TTCAGGAGATATTCTAATGGGGG - Intergenic
1168902720 20:1378574-1378596 CACACGTACCATTCTAGTGGGGG + Intronic
1170406741 20:16045859-16045881 CTCAGGTAGCAGTGTAAAGGAGG - Intronic
1172937517 20:38630924-38630946 CTTAGGTAACATTTTACTGAGGG + Intronic
1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG + Intronic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1179414054 21:41184203-41184225 CTCAGGAAATATACTAATGCAGG - Intronic
1180939762 22:19651908-19651930 CACAGCTAACATCATAATGGTGG + Intergenic
950961107 3:17108957-17108979 TGGAGGTTACATTCTAATGGGGG + Intergenic
957947369 3:87082067-87082089 GTCAGGTAAGATTCTCCTGGGGG - Intergenic
959050567 3:101520725-101520747 CTAAGGCAAAATTCAAATGGTGG - Intergenic
962186949 3:133270258-133270280 CTCAGCTTGCATTCTAGTGGTGG - Intronic
964004889 3:151815073-151815095 CACAGTTGACATTCTAGTGGTGG + Intronic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
969439134 4:7207149-7207171 CTCAGGGGGCCTTCTAATGGAGG + Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977546477 4:98387818-98387840 CTCTGATAACATTCTCCTGGAGG + Intronic
979213076 4:118130600-118130622 CTATGATAACATTGTAATGGTGG - Intronic
980625334 4:135367951-135367973 CTCAGTAAACATACTAATAGGGG - Intergenic
981469438 4:145113640-145113662 TTTAGGTGACATTCTAAGGGCGG + Intronic
983090967 4:163501844-163501866 CTCAGGTTACTTTCTCAGGGAGG + Intronic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
986421921 5:7593757-7593779 CTCATGACACATTCTAATTGGGG + Intronic
986758975 5:10862774-10862796 CTCAGATCTCATTCTAATGTGGG - Intergenic
986814988 5:11399064-11399086 CGAAGGTCACATTTTAATGGTGG + Intronic
989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG + Intergenic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
993431240 5:87834252-87834274 TTCAGGCAACGTTCTACTGGGGG + Intergenic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
997828430 5:137128424-137128446 CTCAGGGAACAATCAGATGGGGG - Intronic
997897161 5:137729424-137729446 CTCAGGTCAGATCCTCATGGTGG + Intronic
1003192373 6:3885934-3885956 CTCAGGTGACATTCAAACAGAGG - Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1007318988 6:41012680-41012702 CTCAGCCAACATTTTCATGGTGG + Intergenic
1008724135 6:54395315-54395337 CTAAGGTTACATTCTGATAGTGG - Intergenic
1008877995 6:56350381-56350403 CCCAGCTAACATTCTTCTGGAGG - Intronic
1009528641 6:64780913-64780935 CTCAAATAACAGTCTAATGTGGG + Intronic
1009869599 6:69436989-69437011 CTAAGGTAACATTCAAATCAAGG - Intergenic
1011399843 6:86948607-86948629 CTGAAGTAACAATCTAATTGGGG + Intronic
1011638593 6:89398925-89398947 GTCAAGTAACATTCAAACGGAGG + Intronic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1013679233 6:112504827-112504849 CTGAGTTAATATTGTAATGGAGG + Intergenic
1015599909 6:134902027-134902049 CTCAGGTCACATAAGAATGGAGG - Intergenic
1015726540 6:136305289-136305311 CTCAGGAAAGATACTAATGCTGG + Intergenic
1023709656 7:42977967-42977989 CTCAGGATACTTTCTAAAGGGGG - Intergenic
1024865685 7:53903368-53903390 CTCAGGAAACTTTCACATGGTGG + Intergenic
1024905050 7:54368221-54368243 TACAGCTAACAATCTAATGGAGG + Intergenic
1028936972 7:96475813-96475835 TTCTGCTAACTTTCTAATGGTGG - Intergenic
1030660898 7:112218230-112218252 ATCAGGTAACAATGTACTGGAGG + Intronic
1031908253 7:127485559-127485581 CTCAGGCAACTTTCAAATAGAGG + Intergenic
1032123851 7:129176435-129176457 CTAAGTTTACATTCTACTGGAGG + Intergenic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1037668333 8:20992291-20992313 CACAGGTAACATTATATTAGTGG + Intergenic
1041631135 8:60088494-60088516 CTCAGTTAACACTTTAAAGGAGG - Intergenic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1047343657 8:124006555-124006577 CCAAGGTGACATTTTAATGGGGG - Intronic
1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG + Intronic
1051843761 9:21428593-21428615 CAAAGGTTACATTGTAATGGGGG - Intronic
1053479203 9:38403440-38403462 CTTATGTAACAGTCTAATGCAGG + Intergenic
1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG + Intergenic
1059717909 9:116930849-116930871 CTCAGGAAGCAATCTAATGGAGG - Intronic
1059837853 9:118177407-118177429 CTCATATAACATTCTAGGGGTGG + Intergenic
1186565015 X:10653016-10653038 TTCAGTTTATATTCTAATGGAGG - Intronic
1191122479 X:56920877-56920899 GTGAGGTAACAGCCTAATGGGGG - Intergenic
1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG + Intergenic
1193730078 X:85092333-85092355 CTCAGGTGACAGTCAAATGTTGG + Exonic
1195682861 X:107561853-107561875 CTCAGGTAACATTTTTTTCGAGG + Intronic
1197997492 X:132393999-132394021 CTAAGGTAGAATGCTAATGGGGG - Intronic