ID: 913570379

View in Genome Browser
Species Human (GRCh38)
Location 1:120114041-120114063
Sequence ATGTATTAGCTGACTAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913570379_913570380 8 Left 913570379 1:120114041-120114063 CCTTATTTAGTCAGCTAATACAT No data
Right 913570380 1:120114072-120114094 CACTCTGATATTGTAAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913570379 Original CRISPR ATGTATTAGCTGACTAAATA AGG (reversed) Intergenic
No off target data available for this crispr