ID: 913574702

View in Genome Browser
Species Human (GRCh38)
Location 1:120160566-120160588
Sequence GGCCATCAAAGTACTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 4, 1: 0, 2: 0, 3: 4, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913574700_913574702 -10 Left 913574700 1:120160553-120160575 CCATTTCTTTCATGGCCATCAAA 0: 4
1: 0
2: 0
3: 257
4: 1799
Right 913574702 1:120160566-120160588 GGCCATCAAAGTACTGAGGTAGG 0: 4
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913574702 Original CRISPR GGCCATCAAAGTACTGAGGT AGG Intronic
904102156 1:28040582-28040604 GGCCATCAAAGGAGAAAGGTGGG + Intronic
907613245 1:55894509-55894531 GGCAAGCAAAGTTTTGAGGTAGG - Intergenic
909517888 1:76532939-76532961 GGCAAGCAAAGAAATGAGGTGGG + Intronic
910047450 1:82934308-82934330 GGCCAGCAGAGTGCTGAGGTTGG + Intergenic
910648185 1:89535957-89535979 GGCCATCACCTTACTGAGTTCGG + Intronic
913574702 1:120160566-120160588 GGCCATCAAAGTACTGAGGTAGG + Intronic
914295971 1:146325406-146325428 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914557011 1:148776192-148776214 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914615823 1:149354038-149354060 GGCCATCAAAGTACTGAGGTAGG - Intergenic
924945476 1:248843539-248843561 AGCCCTCCAAGGACTGAGGTGGG + Intronic
1063273902 10:4542513-4542535 GGGCATTAGAGTACAGAGGTGGG - Intergenic
1064552369 10:16517060-16517082 AGCCATCAAACTATTGAGGAAGG + Intronic
1068716830 10:60198186-60198208 GGCCAGCAAAGCTCTGTGGTGGG - Intronic
1075475276 10:122728783-122728805 GCCCATCAAAGTACTAAGAGAGG + Intergenic
1076100624 10:127774784-127774806 GGCCATCAAAGGAGGGAGATTGG + Intergenic
1076864987 10:133162033-133162055 GGCCGGCACAGTACTGGGGTGGG + Intronic
1077702858 11:4457750-4457772 GGCCATCCATGTACTGGAGTAGG - Intergenic
1080447458 11:32350850-32350872 TGCCATCAAAGAACTAAGGAGGG + Intergenic
1081383143 11:42441010-42441032 GGCCAACACAGTGCTGAGATTGG - Intergenic
1083459280 11:62799926-62799948 GGCCATCACAGTACAAAGGAGGG + Intronic
1093593895 12:20939450-20939472 TGACATCAAATCACTGAGGTAGG - Intergenic
1107332147 13:39312443-39312465 GCCCAGCAAATGACTGAGGTTGG + Intergenic
1109518499 13:63476658-63476680 GGCCAGCAAACTATGGAGGTGGG - Intergenic
1115471410 14:33772361-33772383 GGCCATCATGGTACTGAAGGGGG - Intronic
1116921978 14:50588224-50588246 GGTCCCCAAAGCACTGAGGTTGG - Intronic
1116999556 14:51358417-51358439 AGCCTTCAAAATACTAAGGTGGG + Intergenic
1127843743 15:62851611-62851633 GGCTATTTAAATACTGAGGTAGG + Intergenic
1132176035 15:99715787-99715809 GGCCATTAGAGTACTGAGGAAGG - Exonic
1133567037 16:7005687-7005709 GGCCATCTCAGGACTGTGGTGGG + Intronic
1134797698 16:17056897-17056919 AGCCAACATAGTGCTGAGGTAGG + Intergenic
1140410419 16:74737670-74737692 AGCAATCACAGTACTGAGCTTGG + Intronic
1140473450 16:75227204-75227226 GGCCATCCAGGTGCTGAGGATGG + Intergenic
1140924604 16:79570308-79570330 GGCCAGCAAAGAGCTGAGGAGGG - Intergenic
1144835652 17:18155358-18155380 GGGCATCAAACTCCTGAGGATGG + Exonic
1156170279 18:34474769-34474791 ATCCATCAAAAAACTGAGGTTGG - Intergenic
1158208379 18:55019860-55019882 GTGCATCAAAGTCATGAGGTGGG - Intergenic
1161581400 19:5082882-5082904 GGCCATCATGGTCCTGGGGTTGG + Intronic
1165299796 19:34961516-34961538 GGCCATCAAAGGTCTGGGGCAGG - Intronic
931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG + Intergenic
932087733 2:68776603-68776625 GGCCAAAAAAGCAATGAGGTTGG - Intronic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
934856915 2:97735265-97735287 GGCCATCAAGGTGCTGAAGCAGG + Exonic
937913363 2:127087142-127087164 GACCATCAAAGCATTGTGGTGGG - Intronic
942901622 2:181126773-181126795 GCCCATAAAACTACTGAGCTGGG + Intergenic
943036991 2:182759587-182759609 GGGCAACAGAGTACTGGGGTGGG - Intronic
943570068 2:189563945-189563967 TCCCATCAAAATACTGAGGATGG + Exonic
945512014 2:210714354-210714376 GGGCATCAAGGTCCTGAGTTTGG - Intergenic
945577683 2:211552645-211552667 GGCCAGCAAAGCTCTGAGGAAGG + Intronic
945791884 2:214315641-214315663 GACACTCAGAGTACTGAGGTGGG - Intronic
947253185 2:228132314-228132336 GTCCATCAAAGCACTGTGGAAGG - Intronic
1170374519 20:15685838-15685860 CCCCATCAAAGTGATGAGGTCGG - Intronic
1171106123 20:22434555-22434577 GGCCACAAAAGCACTGGGGTAGG - Intergenic
1173688808 20:44942974-44942996 GGCCATCAAGGGATTGAGGAGGG + Exonic
1177978895 21:27885589-27885611 GGCCCTCATAGTGCAGAGGTGGG + Intergenic
1181903441 22:26173960-26173982 GGCCATCAACGTATTGATTTAGG + Intronic
949158340 3:852705-852727 TGACATCAAGTTACTGAGGTAGG + Intergenic
950849718 3:16051160-16051182 GGCCGTCACATTACTGAGGGAGG - Intergenic
951893154 3:27585513-27585535 GGGCATAAAAGTACTTAGGTGGG + Intergenic
954901643 3:54025286-54025308 GGCCCTCAAGGTGCTGAGGAAGG + Intergenic
960229653 3:115210201-115210223 GGCCATCAAAATAAAGAGGGAGG - Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
962016071 3:131441821-131441843 GGCAATCACAGTGCTGGGGTTGG + Intergenic
962877619 3:139547805-139547827 GCCCATAAAAGGACTGAAGTGGG + Intergenic
976983216 4:91258866-91258888 GGTCATCAATGTACTGAAGGTGG + Intronic
978009804 4:103666333-103666355 GAACAGCAAAGTCCTGAGGTAGG + Intronic
982338802 4:154271628-154271650 GGACATCAAAGTACTAACTTGGG - Intronic
983779985 4:171656982-171657004 ATCCATCAATGCACTGAGGTTGG - Intergenic
990931815 5:61100260-61100282 GGCTTTCAAAGTTCTGAGGATGG - Intronic
992018097 5:72595801-72595823 GCACAGCAAGGTACTGAGGTTGG + Intergenic
992299926 5:75367706-75367728 TGCTATCAATGTACAGAGGTTGG + Intergenic
992758467 5:79931065-79931087 TGCCATCAAAGTGCTCAGGAGGG + Intergenic
993437525 5:87916133-87916155 GGCCAGCCTAGTACTGGGGTGGG - Intergenic
1000517395 5:162255673-162255695 GGCAGTCATAGTACTAAGGTTGG - Intergenic
1001555069 5:172631579-172631601 GGGCATCACAGTCCTGCGGTGGG - Intergenic
1011797679 6:90975056-90975078 AGCCATTAAGGCACTGAGGTGGG + Intergenic
1015566564 6:134578310-134578332 GGTCATCAAAGTTCAGAGGTAGG - Intergenic
1028699156 7:93756746-93756768 GGCCAACAAAGTACTGACTGAGG - Intronic
1032684324 7:134216120-134216142 CCCCATAAAAATACTGAGGTAGG - Intronic
1033585601 7:142772271-142772293 GCCCAGGGAAGTACTGAGGTTGG + Intergenic
1033607553 7:142938451-142938473 GCGCATCCAAGTACTGAGGCAGG + Intergenic
1038258797 8:25974845-25974867 GGCCCTCAAAGTGCTGAGTGTGG - Intronic
1038595872 8:28885780-28885802 GGCCATCAGCGTACTCAGTTAGG + Intronic
1039174716 8:34790706-34790728 GGCCATGAAAAAACTGGGGTAGG + Intergenic
1043488669 8:80725165-80725187 TTCCAGCAAAGTACTGTGGTAGG + Intronic
1044521709 8:93206275-93206297 GGCCATCAAAGGAAAGGGGTGGG - Intergenic
1052791055 9:32876050-32876072 GCACATGAAACTACTGAGGTGGG - Intergenic
1052901317 9:33796865-33796887 GCCCAGGGAAGTACTGAGGTTGG + Intronic
1062720294 9:138038428-138038450 GGCCACCAGAGTACAGGGGTGGG - Intronic
1185483337 X:464415-464437 TGCCATCCAAGTACTGAGCATGG - Intergenic
1189266561 X:39721144-39721166 GGCAAGCAAAGTGCTGAAGTTGG - Intergenic
1197705032 X:129628821-129628843 GGAAACCAAAGGACTGAGGTGGG + Intergenic
1200083940 X:153593587-153593609 GGCTTTCCAGGTACTGAGGTGGG + Intronic