ID: 913574888

View in Genome Browser
Species Human (GRCh38)
Location 1:120162186-120162208
Sequence ACCAGTATGCTACTGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913574879_913574888 11 Left 913574879 1:120162152-120162174 CCCCCTTATACATTCAGGCCTAG 0: 4
1: 0
2: 0
3: 10
4: 79
Right 913574888 1:120162186-120162208 ACCAGTATGCTACTGGTCAGAGG No data
913574884_913574888 8 Left 913574884 1:120162155-120162177 CCTTATACATTCAGGCCTAGGGA 0: 4
1: 0
2: 0
3: 6
4: 96
Right 913574888 1:120162186-120162208 ACCAGTATGCTACTGGTCAGAGG No data
913574886_913574888 -7 Left 913574886 1:120162170-120162192 CCTAGGGATGGTAACAACCAGTA No data
Right 913574888 1:120162186-120162208 ACCAGTATGCTACTGGTCAGAGG No data
913574880_913574888 10 Left 913574880 1:120162153-120162175 CCCCTTATACATTCAGGCCTAGG 0: 4
1: 0
2: 0
3: 13
4: 110
Right 913574888 1:120162186-120162208 ACCAGTATGCTACTGGTCAGAGG No data
913574882_913574888 9 Left 913574882 1:120162154-120162176 CCCTTATACATTCAGGCCTAGGG 0: 4
1: 0
2: 3
3: 9
4: 116
Right 913574888 1:120162186-120162208 ACCAGTATGCTACTGGTCAGAGG No data
913574878_913574888 14 Left 913574878 1:120162149-120162171 CCTCCCCCTTATACATTCAGGCC 0: 4
1: 0
2: 3
3: 5
4: 116
Right 913574888 1:120162186-120162208 ACCAGTATGCTACTGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913574888 Original CRISPR ACCAGTATGCTACTGGTCAG AGG Intronic
No off target data available for this crispr