ID: 913582654

View in Genome Browser
Species Human (GRCh38)
Location 1:120242046-120242068
Sequence GATTCAGAAGTACCTCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913582649_913582654 20 Left 913582649 1:120242003-120242025 CCTTGCCTTTGCTGGGATAAATT No data
Right 913582654 1:120242046-120242068 GATTCAGAAGTACCTCCTTTAGG No data
913582650_913582654 15 Left 913582650 1:120242008-120242030 CCTTTGCTGGGATAAATTTGTAT No data
Right 913582654 1:120242046-120242068 GATTCAGAAGTACCTCCTTTAGG No data
913582652_913582654 -9 Left 913582652 1:120242032-120242054 CCCTTCAGAGGTTAGATTCAGAA No data
Right 913582654 1:120242046-120242068 GATTCAGAAGTACCTCCTTTAGG No data
913582653_913582654 -10 Left 913582653 1:120242033-120242055 CCTTCAGAGGTTAGATTCAGAAG No data
Right 913582654 1:120242046-120242068 GATTCAGAAGTACCTCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913582654 Original CRISPR GATTCAGAAGTACCTCCTTT AGG Intergenic
No off target data available for this crispr