ID: 913596774

View in Genome Browser
Species Human (GRCh38)
Location 1:120386202-120386224
Sequence TTCCATGTTTTTGTTTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913596774_913596777 18 Left 913596774 1:120386202-120386224 CCTATGGAAACAAAAACATGGAA No data
Right 913596777 1:120386243-120386265 TAACTTCTCTGTAGTCCTGAGGG No data
913596774_913596778 21 Left 913596774 1:120386202-120386224 CCTATGGAAACAAAAACATGGAA No data
Right 913596778 1:120386246-120386268 CTTCTCTGTAGTCCTGAGGGTGG No data
913596774_913596776 17 Left 913596774 1:120386202-120386224 CCTATGGAAACAAAAACATGGAA No data
Right 913596776 1:120386242-120386264 ATAACTTCTCTGTAGTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913596774 Original CRISPR TTCCATGTTTTTGTTTCCAT AGG (reversed) Intergenic