ID: 913596777

View in Genome Browser
Species Human (GRCh38)
Location 1:120386243-120386265
Sequence TAACTTCTCTGTAGTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913596774_913596777 18 Left 913596774 1:120386202-120386224 CCTATGGAAACAAAAACATGGAA No data
Right 913596777 1:120386243-120386265 TAACTTCTCTGTAGTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913596777 Original CRISPR TAACTTCTCTGTAGTCCTGA GGG Intergenic
No off target data available for this crispr