ID: 913597741 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:120394453-120394475 |
| Sequence | CAACCCAAGCAATATTTTAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 913597741_913597746 | 28 | Left | 913597741 | 1:120394453-120394475 | CCCTTAAAATATTGCTTGGGTTG | No data | ||
| Right | 913597746 | 1:120394504-120394526 | CCTACAGCCATTAGCCTCAGTGG | No data | ||||
| 913597741_913597743 | -2 | Left | 913597741 | 1:120394453-120394475 | CCCTTAAAATATTGCTTGGGTTG | No data | ||
| Right | 913597743 | 1:120394474-120394496 | TGCCTTAGATCTAGTCATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 913597741 | Original CRISPR | CAACCCAAGCAATATTTTAA GGG (reversed) | Intergenic | ||