ID: 913597742

View in Genome Browser
Species Human (GRCh38)
Location 1:120394454-120394476
Sequence GCAACCCAAGCAATATTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913597742_913597746 27 Left 913597742 1:120394454-120394476 CCTTAAAATATTGCTTGGGTTGC No data
Right 913597746 1:120394504-120394526 CCTACAGCCATTAGCCTCAGTGG No data
913597742_913597743 -3 Left 913597742 1:120394454-120394476 CCTTAAAATATTGCTTGGGTTGC No data
Right 913597743 1:120394474-120394496 TGCCTTAGATCTAGTCATGTTGG No data
913597742_913597747 30 Left 913597742 1:120394454-120394476 CCTTAAAATATTGCTTGGGTTGC No data
Right 913597747 1:120394507-120394529 ACAGCCATTAGCCTCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913597742 Original CRISPR GCAACCCAAGCAATATTTTA AGG (reversed) Intergenic