ID: 913597743 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:120394474-120394496 |
Sequence | TGCCTTAGATCTAGTCATGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
913597741_913597743 | -2 | Left | 913597741 | 1:120394453-120394475 | CCCTTAAAATATTGCTTGGGTTG | No data | ||
Right | 913597743 | 1:120394474-120394496 | TGCCTTAGATCTAGTCATGTTGG | No data | ||||
913597742_913597743 | -3 | Left | 913597742 | 1:120394454-120394476 | CCTTAAAATATTGCTTGGGTTGC | No data | ||
Right | 913597743 | 1:120394474-120394496 | TGCCTTAGATCTAGTCATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
913597743 | Original CRISPR | TGCCTTAGATCTAGTCATGT TGG | Intergenic | ||