ID: 913597743

View in Genome Browser
Species Human (GRCh38)
Location 1:120394474-120394496
Sequence TGCCTTAGATCTAGTCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913597741_913597743 -2 Left 913597741 1:120394453-120394475 CCCTTAAAATATTGCTTGGGTTG No data
Right 913597743 1:120394474-120394496 TGCCTTAGATCTAGTCATGTTGG No data
913597742_913597743 -3 Left 913597742 1:120394454-120394476 CCTTAAAATATTGCTTGGGTTGC No data
Right 913597743 1:120394474-120394496 TGCCTTAGATCTAGTCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913597743 Original CRISPR TGCCTTAGATCTAGTCATGT TGG Intergenic