ID: 913600176

View in Genome Browser
Species Human (GRCh38)
Location 1:120414996-120415018
Sequence GCCCCGCTGCGCCTGCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913600166_913600176 28 Left 913600166 1:120414945-120414967 CCTGGCCCGCGCGAACCCGCTGT No data
Right 913600176 1:120414996-120415018 GCCCCGCTGCGCCTGCGCCTTGG No data
913600171_913600176 13 Left 913600171 1:120414960-120414982 CCCGCTGTGCTGCAGAGGCGGCC No data
Right 913600176 1:120414996-120415018 GCCCCGCTGCGCCTGCGCCTTGG No data
913600168_913600176 22 Left 913600168 1:120414951-120414973 CCGCGCGAACCCGCTGTGCTGCA No data
Right 913600176 1:120414996-120415018 GCCCCGCTGCGCCTGCGCCTTGG No data
913600174_913600176 -8 Left 913600174 1:120414981-120415003 CCATGTACCTTTAAGGCCCCGCT No data
Right 913600176 1:120414996-120415018 GCCCCGCTGCGCCTGCGCCTTGG No data
913600167_913600176 23 Left 913600167 1:120414950-120414972 CCCGCGCGAACCCGCTGTGCTGC No data
Right 913600176 1:120414996-120415018 GCCCCGCTGCGCCTGCGCCTTGG No data
913600172_913600176 12 Left 913600172 1:120414961-120414983 CCGCTGTGCTGCAGAGGCGGCCA No data
Right 913600176 1:120414996-120415018 GCCCCGCTGCGCCTGCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913600176 Original CRISPR GCCCCGCTGCGCCTGCGCCT TGG Intergenic