ID: 913608446

View in Genome Browser
Species Human (GRCh38)
Location 1:120488032-120488054
Sequence AGAGAGAATCTAATGGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913608446_913608454 1 Left 913608446 1:120488032-120488054 CCCCAAGCCATTAGATTCTCTCT No data
Right 913608454 1:120488056-120488078 AGAGAATTTCCTATGGTTGGGGG No data
913608446_913608450 -6 Left 913608446 1:120488032-120488054 CCCCAAGCCATTAGATTCTCTCT No data
Right 913608450 1:120488049-120488071 CTCTCTCAGAGAATTTCCTATGG No data
913608446_913608453 0 Left 913608446 1:120488032-120488054 CCCCAAGCCATTAGATTCTCTCT No data
Right 913608453 1:120488055-120488077 CAGAGAATTTCCTATGGTTGGGG No data
913608446_913608451 -2 Left 913608446 1:120488032-120488054 CCCCAAGCCATTAGATTCTCTCT No data
Right 913608451 1:120488053-120488075 CTCAGAGAATTTCCTATGGTTGG No data
913608446_913608452 -1 Left 913608446 1:120488032-120488054 CCCCAAGCCATTAGATTCTCTCT No data
Right 913608452 1:120488054-120488076 TCAGAGAATTTCCTATGGTTGGG No data
913608446_913608457 15 Left 913608446 1:120488032-120488054 CCCCAAGCCATTAGATTCTCTCT No data
Right 913608457 1:120488070-120488092 GGTTGGGGGAGAGGTGTCATAGG No data
913608446_913608455 6 Left 913608446 1:120488032-120488054 CCCCAAGCCATTAGATTCTCTCT No data
Right 913608455 1:120488061-120488083 ATTTCCTATGGTTGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913608446 Original CRISPR AGAGAGAATCTAATGGCTTG GGG (reversed) Intergenic
No off target data available for this crispr