ID: 913609939

View in Genome Browser
Species Human (GRCh38)
Location 1:120501218-120501240
Sequence GGTCAGACTGCAGCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913609939_913609945 4 Left 913609939 1:120501218-120501240 CCAGCTTGTGCTGCAGTCTGACC No data
Right 913609945 1:120501245-120501267 AGAGGCAAGGCCCACTGAGATGG No data
913609939_913609943 -9 Left 913609939 1:120501218-120501240 CCAGCTTGTGCTGCAGTCTGACC No data
Right 913609943 1:120501232-120501254 AGTCTGACCAGGGAGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913609939 Original CRISPR GGTCAGACTGCAGCACAAGC TGG (reversed) Intergenic
No off target data available for this crispr