ID: 913610506

View in Genome Browser
Species Human (GRCh38)
Location 1:120505569-120505591
Sequence AAAATGCAAGAGCTGTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913610506_913610515 29 Left 913610506 1:120505569-120505591 CCCTGATACAGCTCTTGCATTTT No data
Right 913610515 1:120505621-120505643 AGGAATGAAATAGTCCTGCCTGG No data
913610506_913610516 30 Left 913610506 1:120505569-120505591 CCCTGATACAGCTCTTGCATTTT No data
Right 913610516 1:120505622-120505644 GGAATGAAATAGTCCTGCCTGGG No data
913610506_913610513 9 Left 913610506 1:120505569-120505591 CCCTGATACAGCTCTTGCATTTT No data
Right 913610513 1:120505601-120505623 CTGTGAGCCAGGGATGGAGGAGG No data
913610506_913610512 6 Left 913610506 1:120505569-120505591 CCCTGATACAGCTCTTGCATTTT No data
Right 913610512 1:120505598-120505620 ACTCTGTGAGCCAGGGATGGAGG No data
913610506_913610510 3 Left 913610506 1:120505569-120505591 CCCTGATACAGCTCTTGCATTTT No data
Right 913610510 1:120505595-120505617 TCCACTCTGTGAGCCAGGGATGG No data
913610506_913610509 -1 Left 913610506 1:120505569-120505591 CCCTGATACAGCTCTTGCATTTT No data
Right 913610509 1:120505591-120505613 TATATCCACTCTGTGAGCCAGGG No data
913610506_913610508 -2 Left 913610506 1:120505569-120505591 CCCTGATACAGCTCTTGCATTTT No data
Right 913610508 1:120505590-120505612 TTATATCCACTCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913610506 Original CRISPR AAAATGCAAGAGCTGTATCA GGG (reversed) Intergenic
No off target data available for this crispr