ID: 913610527

View in Genome Browser
Species Human (GRCh38)
Location 1:120505711-120505733
Sequence CTGTGGGTTTGGAGTTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913610520_913610527 26 Left 913610520 1:120505662-120505684 CCAAATGAGACTTCTTTTCAAAG No data
Right 913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG No data
913610522_913610527 -1 Left 913610522 1:120505689-120505711 CCATCTCTGCTTTGTGCTTTACC No data
Right 913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913610527 Original CRISPR CTGTGGGTTTGGAGTTAAGC TGG Intergenic
No off target data available for this crispr