ID: 913611341

View in Genome Browser
Species Human (GRCh38)
Location 1:120512545-120512567
Sequence CTCTTTCCTGTCTGATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 2, 2: 1, 3: 25, 4: 191}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913611341_913611349 16 Left 913611341 1:120512545-120512567 CCAGCTCATCAGACAGGAAAGAG 0: 1
1: 2
2: 1
3: 25
4: 191
Right 913611349 1:120512584-120512606 GGTGGGAGTCAGACAAGGCACGG No data
913611341_913611348 11 Left 913611341 1:120512545-120512567 CCAGCTCATCAGACAGGAAAGAG 0: 1
1: 2
2: 1
3: 25
4: 191
Right 913611348 1:120512579-120512601 AGAGCGGTGGGAGTCAGACAAGG No data
913611341_913611352 27 Left 913611341 1:120512545-120512567 CCAGCTCATCAGACAGGAAAGAG 0: 1
1: 2
2: 1
3: 25
4: 191
Right 913611352 1:120512595-120512617 GACAAGGCACGGCTGCTGGAGGG No data
913611341_913611350 23 Left 913611341 1:120512545-120512567 CCAGCTCATCAGACAGGAAAGAG 0: 1
1: 2
2: 1
3: 25
4: 191
Right 913611350 1:120512591-120512613 GTCAGACAAGGCACGGCTGCTGG No data
913611341_913611347 -1 Left 913611341 1:120512545-120512567 CCAGCTCATCAGACAGGAAAGAG 0: 1
1: 2
2: 1
3: 25
4: 191
Right 913611347 1:120512567-120512589 GGTGCTGCTGGGAGAGCGGTGGG 0: 2
1: 0
2: 3
3: 21
4: 311
913611341_913611345 -5 Left 913611341 1:120512545-120512567 CCAGCTCATCAGACAGGAAAGAG 0: 1
1: 2
2: 1
3: 25
4: 191
Right 913611345 1:120512563-120512585 AAGAGGTGCTGCTGGGAGAGCGG 0: 2
1: 0
2: 3
3: 45
4: 518
913611341_913611351 26 Left 913611341 1:120512545-120512567 CCAGCTCATCAGACAGGAAAGAG 0: 1
1: 2
2: 1
3: 25
4: 191
Right 913611351 1:120512594-120512616 AGACAAGGCACGGCTGCTGGAGG No data
913611341_913611346 -2 Left 913611341 1:120512545-120512567 CCAGCTCATCAGACAGGAAAGAG 0: 1
1: 2
2: 1
3: 25
4: 191
Right 913611346 1:120512566-120512588 AGGTGCTGCTGGGAGAGCGGTGG 0: 2
1: 0
2: 4
3: 35
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913611341 Original CRISPR CTCTTTCCTGTCTGATGAGC TGG (reversed) Intergenic
900081444 1:861093-861115 CTGTCTCCTGTCTGAAGAGGAGG - Intergenic
901721853 1:11205056-11205078 CTCTTCACTGTCAGATGAGCTGG - Intronic
902275623 1:15337331-15337353 CTCTCTCCCGTCTGATGACGAGG + Intronic
902921492 1:19668357-19668379 CTCATTCCAGCCTGAAGAGCTGG + Intronic
906208855 1:44001157-44001179 CTCTTACCTGGCTGGTGAGGGGG + Exonic
906557157 1:46723004-46723026 CTCTTGCCTGTCTCATGTGAGGG - Intergenic
906638416 1:47425782-47425804 TGCTTCCCTGTCTGATGGGCAGG + Intergenic
907415858 1:54313382-54313404 CTAGTTCCTGGCTGAGGAGCAGG - Intronic
907550790 1:55303068-55303090 CTGTTTCCTGACTGATGCACAGG - Intergenic
907583273 1:55591354-55591376 CTCTTTCTAGTATGATGACCAGG + Intergenic
911012527 1:93296653-93296675 CTCTTTCCTGTCTCAAGTGAAGG + Intergenic
912386316 1:109272899-109272921 CTCCTCACTGTCTGATGAGTGGG - Exonic
912434436 1:109650587-109650609 CTCTTTTCTGTGTGATTTGCAGG - Intergenic
913611341 1:120512545-120512567 CTCTTTCCTGTCTGATGAGCTGG - Intergenic
913983449 1:143544277-143544299 CTTTTTCCTGTCTGATGAGCTGG + Intergenic
914579851 1:149009694-149009716 CTCTTTCCTGTCTGATGAACTGG + Exonic
915540179 1:156561015-156561037 CTCTTCCCTCTCTTAGGAGCTGG - Exonic
915894856 1:159803899-159803921 CTATTTCCTCTCTCAAGAGCAGG + Intronic
917878808 1:179312966-179312988 CTCTTTGCTGTCTGATACTCAGG + Intronic
918209514 1:182338651-182338673 CTCTTCCCTGTTTGATGGGCTGG + Intergenic
918374531 1:183895900-183895922 CTCTCTCCTATCTAATGAGGAGG + Intronic
919011516 1:191971593-191971615 TTCCTTCCTGCCTGATAAGCAGG - Intergenic
919193209 1:194249905-194249927 CTTTTTCCTTTCTGATCTGCTGG - Intergenic
919748044 1:201020870-201020892 GCCTTCCCTGTCTGAAGAGCTGG + Intronic
919882011 1:201907026-201907048 ATCTTTGATGTCTAATGAGCTGG - Intronic
921305652 1:213793765-213793787 CACTTTTCTGTCTGATGAGTAGG + Intergenic
922219231 1:223545024-223545046 CCCTTTGCTGTCTGAACAGCAGG + Intronic
922553045 1:226511376-226511398 TTGTTTCGTGTTTGATGAGCTGG - Intergenic
922794632 1:228333960-228333982 CTCTGTCCTGACTGATGGGCAGG + Intronic
923693422 1:236220857-236220879 CTATTTCCTGTCGGGTGAGTTGG + Exonic
924062826 1:240193974-240193996 CTATTTCCTGTATGATTGGCTGG + Intronic
1062909776 10:1205138-1205160 CCCTTTCCTGGCAGATCAGCTGG - Intronic
1065837074 10:29668296-29668318 TTCTTTCCTTGGTGATGAGCAGG - Intronic
1067724503 10:48759669-48759691 CTGTTTCTGGTCTGAGGAGCAGG - Intronic
1067931962 10:50570910-50570932 CTCTCTGTTGTCTGATGACCGGG - Intronic
1068254026 10:54484643-54484665 CTCCTCCTTCTCTGATGAGCGGG - Intronic
1069285742 10:66713186-66713208 CTCATTTCTGTCTGTTGAGAAGG - Intronic
1072439427 10:95440532-95440554 CTCTTAGCTGCATGATGAGCAGG + Intronic
1072600218 10:96919327-96919349 TTCTTTCCTTTCTTATGAACTGG + Intronic
1073331487 10:102672880-102672902 CTTTTTCCTGTCTGTTGGGCTGG + Intergenic
1076913427 10:133403936-133403958 CTTTGGCCTGTCTGATGGGCGGG + Intronic
1077911592 11:6576805-6576827 CTCTTCCCATTCTGATGAACGGG + Intronic
1078141841 11:8698926-8698948 CTCTTACCTGTCGGATGAATCGG + Exonic
1079124426 11:17708712-17708734 TTCTTTCCAGTCTGGGGAGCAGG + Intergenic
1082120304 11:48372896-48372918 TTCTTTCTTGTCTCATGGGCTGG - Intergenic
1082253994 11:50012322-50012344 TTCTTTCTTGTCTCATGGGCTGG + Intergenic
1084467167 11:69331428-69331450 TTCTTTTCTTTCTGATGAGTAGG + Intronic
1088002434 11:104898422-104898444 CTTTTTCCTGTCCGGGGAGCAGG - Intergenic
1089196820 11:116698431-116698453 CTCTTTCCAGTCTCATGATATGG + Intergenic
1089650717 11:119910973-119910995 CTCTTTCCTGCCTCATTTGCAGG - Intergenic
1090266864 11:125358884-125358906 CCTTTGCCTGTCTCATGAGCGGG - Intronic
1090801114 11:130172984-130173006 TTCTTTCCTTTCTGGGGAGCTGG + Intronic
1091215723 11:133900248-133900270 CCCTTTTCTGAGTGATGAGCAGG + Intergenic
1091818752 12:3458838-3458860 CTCCTTCCTGTCTGTTCACCTGG + Intronic
1092720545 12:11436235-11436257 ATCTTGCATGTCTGTTGAGCTGG - Intronic
1096231131 12:49897510-49897532 CTCTTTACTTTCTGGTGAGTTGG - Exonic
1098773681 12:74586544-74586566 CTCTTTCTGGTCAGAGGAGCAGG - Intergenic
1099007015 12:77246305-77246327 CTCTTTTCTGTCTTAAAAGCAGG + Intergenic
1100199458 12:92282659-92282681 CTCTCTCCTATCTAATTAGCTGG - Intergenic
1101234101 12:102770672-102770694 CTCTGTCCTGCCTGAAGATCGGG - Intergenic
1102203449 12:111074452-111074474 CTGTTCCCTGCCTGATCAGCTGG + Intronic
1102839986 12:116108532-116108554 AGCTTTCCTATCTCATGAGCAGG + Intronic
1103539971 12:121659234-121659256 CACTTTCCTGTCTGTTGGTCAGG + Exonic
1103596790 12:122029166-122029188 CCATTTCCTGCCGGATGAGCCGG + Intronic
1103860773 12:124011628-124011650 GGCTTTCCTGTCTGATGTGCAGG + Exonic
1105294013 13:19072676-19072698 CTGTGTCCTGTCTGCAGAGCAGG - Intergenic
1108455956 13:50613843-50613865 CTCTTTCCTGAGTGATGGGTGGG - Intronic
1114757328 14:25274236-25274258 CCCTTTTCTCTCTGATGAACTGG - Intergenic
1118832838 14:69450896-69450918 GGCTTTCGTGTCTGATGACCTGG + Intronic
1119103208 14:71899314-71899336 CTCTTCCCTGTATTATTAGCAGG + Intergenic
1123063950 14:105606795-105606817 CCCCTTCCTGTCTGAGGGGCCGG + Intergenic
1123073264 14:105652438-105652460 CCCCTTCCTGTCTGAGGGGCTGG + Intergenic
1127129618 15:55848843-55848865 GTCTTTCCTCTCAGATGGGCTGG + Exonic
1129193211 15:73949609-73949631 CCCTTTCCTGCCTGGGGAGCAGG + Intronic
1129461252 15:75701100-75701122 CTCTTGCCAGTCTGCTGGGCTGG - Intronic
1129723574 15:77890638-77890660 CTCTTGCCAGTCTGCTGGGCTGG + Intergenic
1129964814 15:79724958-79724980 CTTTTTCCTGACTGCTGACCTGG - Intergenic
1132402833 15:101523889-101523911 CTGTTCCCTCCCTGATGAGCAGG - Intronic
1132867006 16:2098052-2098074 CTCTGTCCTGTCTGCTGAGGAGG - Intronic
1132987164 16:2773432-2773454 CTCATTCTTTTGTGATGAGCCGG + Intronic
1133378978 16:5314104-5314126 CTCTTGACAATCTGATGAGCTGG + Intergenic
1133499459 16:6352026-6352048 CTTTTTTCTGTCTGTTGGGCAGG + Intronic
1133988217 16:10684591-10684613 CCCTGTCCTGCCTAATGAGCTGG + Intronic
1134524768 16:14935070-14935092 CTCTGTCCTGTCTGCTGAGGAGG + Intronic
1134548138 16:15125875-15125897 CTCTGTCCTGTCTGCTGAGGAGG - Intronic
1134712357 16:16333557-16333579 CTCTGTCCTGTCTGCTGAGGAGG + Intergenic
1134720215 16:16376850-16376872 CTCTGTCCTGTCTGCTGAGGAGG + Intergenic
1134947212 16:18335035-18335057 CTCTGTCCTGTCTGCTGAGGAGG - Intronic
1134954471 16:18375137-18375159 CTCTGTCCTGTCTGCTGAGGAGG - Intergenic
1141743269 16:85908668-85908690 CCCTTGCCTGGCTGAAGAGCTGG - Intronic
1144823412 17:18091149-18091171 CTGCTTCCTGCCTCATGAGCAGG - Intronic
1147155584 17:38543123-38543145 CTCTTTCAGGTCTAATGAGCAGG - Intronic
1147421741 17:40325337-40325359 CTGTTTCCTGTCTGTTCACCAGG - Intronic
1149543617 17:57487197-57487219 ATCTTTGCGGTCTCATGAGCTGG - Intronic
1151820181 17:76492898-76492920 CTCTTTCCTGTCTGGAGGGGAGG - Intronic
1152001610 17:77649307-77649329 TTCTTTCCTGTCTGCTGAGAGGG - Intergenic
1152242805 17:79169069-79169091 CTCTTTCCTGAGAGCTGAGCAGG - Intronic
1152316133 17:79581438-79581460 TTCTTTCCTGCCTGATGCTCTGG - Intergenic
1154097114 18:11428857-11428879 CTTTGTCCTGTCTGATAATCTGG + Intergenic
1155032590 18:21997284-21997306 CTCTGCCCTGTCTCATGGGCTGG + Intergenic
1156203328 18:34858387-34858409 CTCTCTCCTACCTGAGGAGCCGG - Exonic
1156460090 18:37316736-37316758 GTCTTTCATGTCTCATGAGTAGG + Intronic
1156662288 18:39359695-39359717 CTCTTTGCTATCTGATTAGTTGG + Intergenic
1159037916 18:63295402-63295424 CTTTCTGCTGTCTGATGTGCTGG - Intronic
1159744628 18:72216138-72216160 CTCTTTCCTGTTTGATAATTGGG - Intergenic
1161490691 19:4559619-4559641 CATTTTCCTGTCTGAGCAGCAGG + Exonic
1162026305 19:7895810-7895832 CTCTTTCTTGGGTGATGAGAAGG - Intronic
1163204190 19:15790307-15790329 CTGTTTGCTGTCTGCTGAGCTGG - Intergenic
1164236236 19:23337146-23337168 CTCTTTCATGTCAGGTGTGCTGG + Intronic
1165719893 19:38071669-38071691 CTCCTTCCTTTGTGATCAGCAGG + Intronic
1166353768 19:42215200-42215222 CTCTGTCCTCTTTGAAGAGCTGG + Exonic
925931882 2:8714617-8714639 CTCCTTCCTGCCTGCTGAGCTGG - Intergenic
926039702 2:9663052-9663074 CTCTTTCCTTTCAGAAAAGCTGG + Intergenic
926112594 2:10192631-10192653 CTGTTTCCTGTCTCAGGAACTGG + Intronic
926168028 2:10533805-10533827 CTTCTTCCTGTCTGGTGAGCTGG - Intergenic
927607232 2:24497322-24497344 CTTGTTCCTTTCTGATGACCCGG + Intronic
927997652 2:27497179-27497201 CTCATTCATGCCTGCTGAGCTGG - Intronic
929855241 2:45632094-45632116 TTCTTTCTGGTCTGAAGAGCAGG + Intergenic
930159457 2:48139241-48139263 CTCTTCCCTGCATGATGAGGAGG + Intergenic
930663735 2:54081729-54081751 CTTTTACATGTCTGATGATCTGG + Intronic
931666050 2:64609992-64610014 GTCTTTCCTGGATGATGACCAGG + Intergenic
932641533 2:73452095-73452117 CTCTGTCATTTCTTATGAGCAGG + Exonic
932715129 2:74095126-74095148 CTCTTTCCAGGCAGATGTGCTGG - Intronic
942130205 2:172871168-172871190 CTAGTTCCTGCCTGATTAGCAGG - Intronic
942285520 2:174412283-174412305 CTTTTTCTTGTCTGAGGAGAGGG + Intronic
943992710 2:194717552-194717574 CTCTGTCATTTCTGATGAGGCGG - Intergenic
945899967 2:215526431-215526453 CTTTATCTTGTCTGATGTGCTGG - Intergenic
947896175 2:233674978-233675000 GTCTTATCTGTCTGATGAGAAGG + Intronic
1170793600 20:19527560-19527582 CTCTCTCCTGCCTCATGAGCAGG - Intronic
1170988536 20:21280859-21280881 CTCCTGCCTGTCTGCTCAGCAGG - Intergenic
1171878601 20:30600080-30600102 CTGTGTCCTGTCTGCAGAGCGGG - Intergenic
1173716243 20:45209230-45209252 CTCTTTCCTGTATTCTGAGAGGG - Intronic
1173926492 20:46784943-46784965 CTCCTTCCGGTCAGCTGAGCTGG + Intergenic
1175705105 20:61170977-61170999 CCCTTGCCTGTCTTATGAGCAGG - Intergenic
1177291780 21:19121871-19121893 CTTTTTTCTATCTGTTGAGCAGG + Intergenic
1177315371 21:19453949-19453971 CTCTTTGCTGTCTGAAGTACTGG + Intergenic
1178081429 21:29070363-29070385 CACTGTCCTGTCTAATTAGCGGG - Intronic
1178138154 21:29651602-29651624 CTATTAACTGACTGATGAGCAGG - Intronic
1179138410 21:38700605-38700627 TTATTTATTGTCTGATGAGCAGG - Intergenic
1180233667 21:46443523-46443545 CTCTATCCGCTCTGAGGAGCTGG - Intronic
1181412754 22:22735725-22735747 CATTTTTCTGTCTGATAAGCTGG - Intronic
949536065 3:4997163-4997185 CTGTCTCCTGTGTGGTGAGCCGG + Intergenic
949836024 3:8271025-8271047 CTCTTACTTATCTCATGAGCTGG + Intergenic
950310448 3:11953403-11953425 CTCTTTGCTGTCTGATGGGCCGG + Intergenic
950863373 3:16169988-16170010 CTCTTTCCTCTTTCATGATCTGG - Intergenic
952129510 3:30344340-30344362 CTCTTTGCTGTCTCATAACCAGG + Intergenic
953563402 3:44012147-44012169 ATCTTTCCTGGCTCATGTGCGGG + Intergenic
957122072 3:76106810-76106832 CCCTTTTCTGTCTGATGAATAGG + Intronic
958457090 3:94345583-94345605 CTCTTTACTATCTGATTGGCCGG + Intergenic
959130697 3:102352879-102352901 CTCTTTACTTTCTGTTTAGCTGG - Intronic
961244701 3:125441044-125441066 CTCCTTCCTGACTACTGAGCAGG + Intergenic
961326884 3:126114210-126114232 GCCTTTTCTGTCTGATGAGAGGG - Intronic
961642417 3:128372964-128372986 TTCCTTCCTGTCTGAGGAGGAGG + Intronic
962443751 3:135447370-135447392 CTCCTTCCTGTCTCAGGATCTGG - Intergenic
962733059 3:138300467-138300489 CTTTTTCCTATCTGAGGAGAAGG - Intronic
962881243 3:139578838-139578860 CACTCTCCTGTGTGATGACCAGG - Intronic
963007815 3:140742250-140742272 CTCTTGCTTGACTGCTGAGCTGG - Intergenic
965454999 3:168888719-168888741 CTGTTTACTTTTTGATGAGCAGG - Intergenic
967255725 3:187589961-187589983 CTTTTTCATGTCTGACTAGCAGG + Intergenic
972670903 4:41213819-41213841 CCCTTTCATGTCTCATGGGCTGG + Intronic
980100992 4:128541075-128541097 TATTTTCCTGTCTGATGAGATGG + Intergenic
982572532 4:157068396-157068418 CCCTTTCCTGCCAGTTGAGCTGG + Intergenic
984376838 4:178942209-178942231 CTGTCTCCTGTCAGATCAGCTGG + Intergenic
986455077 5:7910428-7910450 CTCCTTCCTGTGTTTTGAGCTGG + Intergenic
986511887 5:8516672-8516694 TTCCTTCCTATTTGATGAGCAGG + Intergenic
988039636 5:25873095-25873117 CTCCTGCCTGTCTCCTGAGCTGG + Intergenic
996121775 5:119680998-119681020 CGCTTTGCTGTCTGATGTACTGG - Intergenic
996613788 5:125415285-125415307 CTGTCTCCTGTCAGATCAGCAGG - Intergenic
997383238 5:133452227-133452249 CTCTTGCCTTTCTGATTACCTGG + Intronic
999925023 5:156366171-156366193 CTCTTTGCTGTGTGAAGAGAGGG + Intronic
1000339881 5:160268903-160268925 CTCCTTCCTCTCTCAAGAGCAGG + Intronic
1002687871 5:181028417-181028439 TTGTATCCTGTCTGATGATCTGG - Intergenic
1003240299 6:4339437-4339459 TTCATTCCTGTCTCATCAGCTGG + Intergenic
1005674850 6:28143267-28143289 CTCTTCCCTCTCTGATCAGCTGG - Intronic
1007061172 6:38942253-38942275 ATCTTTCCTTACTGGTGAGCTGG + Intronic
1007249195 6:40484157-40484179 CTATTTCCTTTATGATGAGGAGG - Intronic
1007388663 6:41536911-41536933 CTCTGTCCTGTCTGAAGCACTGG - Intergenic
1010797291 6:80132158-80132180 CTCTACCCTGTCTGATTACCTGG + Intronic
1016743648 6:147554620-147554642 TTCTCTCCTGTCTGGTGAGGGGG - Intronic
1018612133 6:165656612-165656634 CTCTCTCCTGTCTTATCACCCGG + Intronic
1020143516 7:5625182-5625204 CTCTTTCCTGCTTGCTGAGCCGG - Intronic
1020269969 7:6589219-6589241 CTCTGACCTGTGTGATGTGCAGG + Exonic
1021895888 7:25235413-25235435 CTCTTTCATCTCTGATGAAAAGG + Intergenic
1022450995 7:30514615-30514637 GTCTTTCCTGTCTGATTAGTCGG + Intronic
1022951003 7:35337868-35337890 CTGCTTCCTGTCAGATCAGCAGG - Intergenic
1025187569 7:56873075-56873097 CTCCTGCCTGTCTGAGTAGCCGG - Intergenic
1025684354 7:63703846-63703868 CTCCTGCCTGTCTGAGTAGCCGG + Intergenic
1026600508 7:71773654-71773676 CTTTATCCTCTCTGATAAGCTGG - Intergenic
1028086659 7:86644759-86644781 CTCTTTTGTGTCGGATGAGGAGG + Exonic
1032543170 7:132721167-132721189 CTCCTTCCTTTCTTCTGAGCTGG - Intronic
1032919684 7:136531678-136531700 CTCTTTCTTGTCTAATTTGCTGG - Intergenic
1035249473 7:157587753-157587775 GCCTCTCCTGTCTGATGAACAGG - Intronic
1035954510 8:4061215-4061237 CTCTTTCCTCTCTAATCAGCAGG - Intronic
1036662339 8:10716318-10716340 GTGTTTCCTGCCTGATAAGCCGG - Intergenic
1038345660 8:26730134-26730156 CTCCTGCCTGACTGATGAGCTGG + Intergenic
1038584749 8:28778578-28778600 CTCTTCCCGGTCTGAGGGGCTGG - Intronic
1039024224 8:33240225-33240247 CACCTTCCTGGCTGGTGAGCAGG + Intergenic
1041795552 8:61743739-61743761 CTCTATGATGTCTCATGAGCAGG - Intergenic
1042421725 8:68598436-68598458 CGCTTTGCTGTCTGAGGAACTGG - Intronic
1043008744 8:74855498-74855520 CTCTTTCATCTCTAATGAGATGG + Intergenic
1044280637 8:90351527-90351549 CTCTTTCTTGGCAGCTGAGCTGG + Intergenic
1047905740 8:129471358-129471380 CTCCTGCCTGACTGTTGAGCTGG - Intergenic
1048161179 8:132023531-132023553 TGCTTTCCTGTCTGAGGAGAGGG + Intergenic
1048292194 8:133189748-133189770 CTCTGTGCTGTGTGATGGGCAGG + Intergenic
1049002277 8:139833658-139833680 CTCTTTCCTGCCTGTTCTGCTGG - Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1050857492 9:10378212-10378234 TTATCTCTTGTCTGATGAGCAGG + Intronic
1050894006 9:10862349-10862371 CTCTTTCATGTATGATGTGAGGG - Intergenic
1052413001 9:28146975-28146997 TTCTTTCTTGTCTGATGGGAAGG - Intronic
1055883419 9:81030834-81030856 CTCTGACCTCTCTGATCAGCTGG + Intergenic
1056898349 9:90573112-90573134 CTCTTTTTTCTCTGTTGAGCTGG + Intergenic
1057571869 9:96210658-96210680 CTCTTTAATGTCTGATAATCTGG + Intergenic
1057915343 9:99051090-99051112 GTCTCTCCTGTGTGATAAGCAGG - Intronic
1058953193 9:109922524-109922546 CTCTTTCCCCTCTGTTGTGCTGG - Intronic
1060754937 9:126205877-126205899 GTCTTCCCTGTCTGAGAAGCAGG - Intergenic
1062702645 9:137915792-137915814 CTTTTTCTTGTCTCATGACCTGG - Intronic
1203560688 Un_KI270744v1:53939-53961 CTCTGTGCTTTCTGATGTGCTGG + Intergenic
1190778672 X:53576447-53576469 CTTTTTATTGTCTGAAGAGCTGG - Intronic
1195213067 X:102669382-102669404 CTCTTTCCTGCCTGCTGACAAGG - Intergenic
1196645657 X:118115706-118115728 TTCTTCCCTGGCTGCTGAGCAGG - Intronic