ID: 913614952

View in Genome Browser
Species Human (GRCh38)
Location 1:120549342-120549364
Sequence ATGTGGACAAGTTCCTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913614952_913614956 -4 Left 913614952 1:120549342-120549364 CCATACTAGGAACTTGTCCACAT No data
Right 913614956 1:120549361-120549383 ACATGGACCAAGTAGGCAAGTGG No data
913614952_913614959 23 Left 913614952 1:120549342-120549364 CCATACTAGGAACTTGTCCACAT No data
Right 913614959 1:120549388-120549410 TAATATGGATCCCTTATACAAGG No data
913614952_913614958 8 Left 913614952 1:120549342-120549364 CCATACTAGGAACTTGTCCACAT No data
Right 913614958 1:120549373-120549395 TAGGCAAGTGGTTTCTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913614952 Original CRISPR ATGTGGACAAGTTCCTAGTA TGG (reversed) Intergenic
No off target data available for this crispr