ID: 913623613

View in Genome Browser
Species Human (GRCh38)
Location 1:120636982-120637004
Sequence CTTTGTGACCTAAAGATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913623613_913623616 -5 Left 913623613 1:120636982-120637004 CCCACTATCTTTAGGTCACAAAG No data
Right 913623616 1:120637000-120637022 CAAAGACATCAGGTGTTTTCAGG No data
913623613_913623617 14 Left 913623613 1:120636982-120637004 CCCACTATCTTTAGGTCACAAAG No data
Right 913623617 1:120637019-120637041 CAGGCTCAATCATGAGTTATTGG No data
913623613_913623618 15 Left 913623613 1:120636982-120637004 CCCACTATCTTTAGGTCACAAAG No data
Right 913623618 1:120637020-120637042 AGGCTCAATCATGAGTTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913623613 Original CRISPR CTTTGTGACCTAAAGATAGT GGG (reversed) Intergenic
No off target data available for this crispr