ID: 913625519

View in Genome Browser
Species Human (GRCh38)
Location 1:120656314-120656336
Sequence GATTCAGAAGTACCTCCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913625519_913625520 -10 Left 913625519 1:120656314-120656336 CCTAAAGGAGGTACTTCTGAATC No data
Right 913625520 1:120656327-120656349 CTTCTGAATCTAACCTCTGAAGG No data
913625519_913625523 15 Left 913625519 1:120656314-120656336 CCTAAAGGAGGTACTTCTGAATC No data
Right 913625523 1:120656352-120656374 ATACAAATTTATCCCAGCAAAGG No data
913625519_913625524 20 Left 913625519 1:120656314-120656336 CCTAAAGGAGGTACTTCTGAATC No data
Right 913625524 1:120656357-120656379 AATTTATCCCAGCAAAGGCAAGG No data
913625519_913625521 -9 Left 913625519 1:120656314-120656336 CCTAAAGGAGGTACTTCTGAATC No data
Right 913625521 1:120656328-120656350 TTCTGAATCTAACCTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913625519 Original CRISPR GATTCAGAAGTACCTCCTTT AGG (reversed) Intergenic
No off target data available for this crispr