ID: 913633217

View in Genome Browser
Species Human (GRCh38)
Location 1:120730114-120730136
Sequence CTCAGGTAACATTCTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913633217_913633221 13 Left 913633217 1:120730114-120730136 CCTCCATTAGAATGTTACCTGAG No data
Right 913633221 1:120730150-120730172 TAGGAGTTCCACAGCCTTTTTGG No data
913633217_913633220 -6 Left 913633217 1:120730114-120730136 CCTCCATTAGAATGTTACCTGAG No data
Right 913633220 1:120730131-120730153 CCTGAGATGTTAGAATGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913633217 Original CRISPR CTCAGGTAACATTCTAATGG AGG (reversed) Intergenic
No off target data available for this crispr