ID: 913633220

View in Genome Browser
Species Human (GRCh38)
Location 1:120730131-120730153
Sequence CCTGAGATGTTAGAATGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913633216_913633220 1 Left 913633216 1:120730107-120730129 CCTTATTCCTCCATTAGAATGTT 0: 6
1: 0
2: 2
3: 25
4: 231
Right 913633220 1:120730131-120730153 CCTGAGATGTTAGAATGCATAGG No data
913633215_913633220 4 Left 913633215 1:120730104-120730126 CCTCCTTATTCCTCCATTAGAAT No data
Right 913633220 1:120730131-120730153 CCTGAGATGTTAGAATGCATAGG No data
913633217_913633220 -6 Left 913633217 1:120730114-120730136 CCTCCATTAGAATGTTACCTGAG No data
Right 913633220 1:120730131-120730153 CCTGAGATGTTAGAATGCATAGG No data
913633218_913633220 -9 Left 913633218 1:120730117-120730139 CCATTAGAATGTTACCTGAGATG No data
Right 913633220 1:120730131-120730153 CCTGAGATGTTAGAATGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913633220 Original CRISPR CCTGAGATGTTAGAATGCAT AGG Intergenic
No off target data available for this crispr