ID: 913633221

View in Genome Browser
Species Human (GRCh38)
Location 1:120730150-120730172
Sequence TAGGAGTTCCACAGCCTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913633215_913633221 23 Left 913633215 1:120730104-120730126 CCTCCTTATTCCTCCATTAGAAT No data
Right 913633221 1:120730150-120730172 TAGGAGTTCCACAGCCTTTTTGG No data
913633219_913633221 -4 Left 913633219 1:120730131-120730153 CCTGAGATGTTAGAATGCATAGG No data
Right 913633221 1:120730150-120730172 TAGGAGTTCCACAGCCTTTTTGG No data
913633218_913633221 10 Left 913633218 1:120730117-120730139 CCATTAGAATGTTACCTGAGATG No data
Right 913633221 1:120730150-120730172 TAGGAGTTCCACAGCCTTTTTGG No data
913633216_913633221 20 Left 913633216 1:120730107-120730129 CCTTATTCCTCCATTAGAATGTT 0: 6
1: 0
2: 2
3: 25
4: 231
Right 913633221 1:120730150-120730172 TAGGAGTTCCACAGCCTTTTTGG No data
913633217_913633221 13 Left 913633217 1:120730114-120730136 CCTCCATTAGAATGTTACCTGAG No data
Right 913633221 1:120730150-120730172 TAGGAGTTCCACAGCCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913633221 Original CRISPR TAGGAGTTCCACAGCCTTTT TGG Intergenic
No off target data available for this crispr