ID: 913634644

View in Genome Browser
Species Human (GRCh38)
Location 1:120746452-120746474
Sequence CTGCTGTGCTTGAAGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913634642_913634644 15 Left 913634642 1:120746414-120746436 CCAAAGTCTGCAGATAAAGATGT No data
Right 913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG No data
913634638_913634644 26 Left 913634638 1:120746403-120746425 CCTTGGATCCCCCAAAGTCTGCA No data
Right 913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG No data
913634641_913634644 16 Left 913634641 1:120746413-120746435 CCCAAAGTCTGCAGATAAAGATG No data
Right 913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG No data
913634639_913634644 18 Left 913634639 1:120746411-120746433 CCCCCAAAGTCTGCAGATAAAGA No data
Right 913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG No data
913634640_913634644 17 Left 913634640 1:120746412-120746434 CCCCAAAGTCTGCAGATAAAGAT No data
Right 913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913634644 Original CRISPR CTGCTGTGCTTGAAGGAAAG AGG Intergenic
No off target data available for this crispr