ID: 913637312

View in Genome Browser
Species Human (GRCh38)
Location 1:120776030-120776052
Sequence CTATAAATACACTTGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913637312_913637316 -9 Left 913637312 1:120776030-120776052 CCAAACTTCAAGTGTATTTATAG No data
Right 913637316 1:120776044-120776066 TATTTATAGGGTCTTTTTAAGGG No data
913637312_913637317 -8 Left 913637312 1:120776030-120776052 CCAAACTTCAAGTGTATTTATAG No data
Right 913637317 1:120776045-120776067 ATTTATAGGGTCTTTTTAAGGGG No data
913637312_913637315 -10 Left 913637312 1:120776030-120776052 CCAAACTTCAAGTGTATTTATAG No data
Right 913637315 1:120776043-120776065 GTATTTATAGGGTCTTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913637312 Original CRISPR CTATAAATACACTTGAAGTT TGG (reversed) Intergenic
No off target data available for this crispr