ID: 913637600

View in Genome Browser
Species Human (GRCh38)
Location 1:120779139-120779161
Sequence TTCAAACATACGCATGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913637600_913637605 -3 Left 913637600 1:120779139-120779161 CCAACCCCATGCGTATGTTTGAA No data
Right 913637605 1:120779159-120779181 GAACAGTAACAATGGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913637600 Original CRISPR TTCAAACATACGCATGGGGT TGG (reversed) Intergenic
No off target data available for this crispr