ID: 913657757

View in Genome Browser
Species Human (GRCh38)
Location 1:120977489-120977511
Sequence TTCATTATACAGCTGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913657757_913657759 4 Left 913657757 1:120977489-120977511 CCATTGTCCAGCTGTATAATGAA No data
Right 913657759 1:120977516-120977538 GAGTTCTCAGAGAAGAATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913657757 Original CRISPR TTCATTATACAGCTGGACAA TGG (reversed) Intergenic
No off target data available for this crispr