ID: 913658197

View in Genome Browser
Species Human (GRCh38)
Location 1:120981880-120981902
Sequence AACCATATAAAGTAACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913658195_913658197 4 Left 913658195 1:120981853-120981875 CCTGGAAAAGGGGCAGGGAGTTT No data
Right 913658197 1:120981880-120981902 AACCATATAAAGTAACTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913658197 Original CRISPR AACCATATAAAGTAACTTCC AGG Intergenic
No off target data available for this crispr