ID: 913658520

View in Genome Browser
Species Human (GRCh38)
Location 1:120984851-120984873
Sequence GAGGAAAACCATAATTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913658520_913658528 26 Left 913658520 1:120984851-120984873 CCAACCCAATTATGGTTTTCCTC No data
Right 913658528 1:120984900-120984922 CTTGGTCTGGACCCTGCAACTGG No data
913658520_913658525 8 Left 913658520 1:120984851-120984873 CCAACCCAATTATGGTTTTCCTC No data
Right 913658525 1:120984882-120984904 TTATGCTGTGAAAGCCTTCTTGG No data
913658520_913658526 13 Left 913658520 1:120984851-120984873 CCAACCCAATTATGGTTTTCCTC No data
Right 913658526 1:120984887-120984909 CTGTGAAAGCCTTCTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913658520 Original CRISPR GAGGAAAACCATAATTGGGT TGG (reversed) Intergenic
No off target data available for this crispr