ID: 913659649

View in Genome Browser
Species Human (GRCh38)
Location 1:120994858-120994880
Sequence TGTGGTCACCAGATGATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913659646_913659649 -5 Left 913659646 1:120994840-120994862 CCCATCTTGTTTTGTCTTTGTGG No data
Right 913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG No data
913659648_913659649 -6 Left 913659648 1:120994841-120994863 CCATCTTGTTTTGTCTTTGTGGT No data
Right 913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG No data
913659643_913659649 22 Left 913659643 1:120994813-120994835 CCTGTCCTGTGTTATATCATGTC No data
Right 913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG No data
913659642_913659649 27 Left 913659642 1:120994808-120994830 CCTGTCCTGTCCTGTGTTATATC No data
Right 913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG No data
913659645_913659649 0 Left 913659645 1:120994835-120994857 CCTGTCCCATCTTGTTTTGTCTT No data
Right 913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG No data
913659644_913659649 17 Left 913659644 1:120994818-120994840 CCTGTGTTATATCATGTCCTGTC No data
Right 913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913659649 Original CRISPR TGTGGTCACCAGATGATGCA AGG Intergenic
No off target data available for this crispr