ID: 913662104

View in Genome Browser
Species Human (GRCh38)
Location 1:121013182-121013204
Sequence CTCCCATAGCAACCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913662104_913662116 22 Left 913662104 1:121013182-121013204 CCCTGGCCTGGTTGCTATGGGAG No data
Right 913662116 1:121013227-121013249 GAGGCAGGTGTGGGAAGATGTGG No data
913662104_913662110 3 Left 913662104 1:121013182-121013204 CCCTGGCCTGGTTGCTATGGGAG No data
Right 913662110 1:121013208-121013230 CAGTGGCCTGATGGAGCCTGAGG No data
913662104_913662109 -6 Left 913662104 1:121013182-121013204 CCCTGGCCTGGTTGCTATGGGAG No data
Right 913662109 1:121013199-121013221 TGGGAGGCACAGTGGCCTGATGG No data
913662104_913662113 12 Left 913662104 1:121013182-121013204 CCCTGGCCTGGTTGCTATGGGAG No data
Right 913662113 1:121013217-121013239 GATGGAGCCTGAGGCAGGTGTGG No data
913662104_913662111 7 Left 913662104 1:121013182-121013204 CCCTGGCCTGGTTGCTATGGGAG No data
Right 913662111 1:121013212-121013234 GGCCTGATGGAGCCTGAGGCAGG No data
913662104_913662114 13 Left 913662104 1:121013182-121013204 CCCTGGCCTGGTTGCTATGGGAG No data
Right 913662114 1:121013218-121013240 ATGGAGCCTGAGGCAGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913662104 Original CRISPR CTCCCATAGCAACCAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr