ID: 913665920

View in Genome Browser
Species Human (GRCh38)
Location 1:121048796-121048818
Sequence AAGTCCTAATTGAGCGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913665920_913665923 30 Left 913665920 1:121048796-121048818 CCCAGGGCGCTCAATTAGGACTT No data
Right 913665923 1:121048849-121048871 ATATACAATCGAACAATGGCCGG No data
913665920_913665922 26 Left 913665920 1:121048796-121048818 CCCAGGGCGCTCAATTAGGACTT No data
Right 913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913665920 Original CRISPR AAGTCCTAATTGAGCGCCCT GGG (reversed) Intergenic
No off target data available for this crispr